ID: 929784890

View in Genome Browser
Species Human (GRCh38)
Location 2:44982288-44982310
Sequence TCAGTAAATCTGCTGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784877_929784890 30 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784882_929784890 -4 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784883_929784890 -7 Left 929784883 2:44982272-44982294 CCCCAGAGTTTCTGATTCAGTAA 0: 18
1: 161
2: 463
3: 902
4: 1606
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784885_929784890 -9 Left 929784885 2:44982274-44982296 CCAGAGTTTCTGATTCAGTAAAT 0: 4
1: 42
2: 332
3: 833
4: 1696
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784880_929784890 -2 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784884_929784890 -8 Left 929784884 2:44982273-44982295 CCCAGAGTTTCTGATTCAGTAAA No data
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784881_929784890 -3 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784890 Original CRISPR TCAGTAAATCTGCTGGGATG GGG Intergenic
No off target data available for this crispr