ID: 929787166

View in Genome Browser
Species Human (GRCh38)
Location 2:45001301-45001323
Sequence GAAGGAACTCCTGGTCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787166_929787170 0 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787170 2:45001324-45001346 TTCCCTTCCTGCTCACCAGCCGG No data
929787166_929787178 20 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787166_929787180 24 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787166_929787175 13 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787166_929787174 7 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787174 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787166 Original CRISPR GAAGGAACTCCTGGTCGCGG TGG (reversed) Intergenic