ID: 929787167

View in Genome Browser
Species Human (GRCh38)
Location 2:45001304-45001326
Sequence GAAGAAGGAACTCCTGGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787167_929787178 17 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787167_929787175 10 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787167_929787180 21 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787167_929787174 4 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787174 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
929787167_929787170 -3 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787170 2:45001324-45001346 TTCCCTTCCTGCTCACCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787167 Original CRISPR GAAGAAGGAACTCCTGGTCG CGG (reversed) Intergenic