ID: 929787169

View in Genome Browser
Species Human (GRCh38)
Location 2:45001319-45001341
Sequence TGGTGAGCAGGAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787169_929787187 30 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787187 2:45001372-45001394 GCACCAACCCGCGCTGGGGGCGG No data
929787169_929787180 6 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787169_929787178 2 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787169_929787185 26 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787185 2:45001368-45001390 AGGAGCACCAACCCGCGCTGGGG No data
929787169_929787184 25 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787184 2:45001367-45001389 AAGGAGCACCAACCCGCGCTGGG No data
929787169_929787183 24 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787169_929787175 -5 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787169_929787186 27 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787186 2:45001369-45001391 GGAGCACCAACCCGCGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787169 Original CRISPR TGGTGAGCAGGAAGGGAAGA AGG (reversed) Intergenic