ID: 929787172

View in Genome Browser
Species Human (GRCh38)
Location 2:45001327-45001349
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787172_929787186 19 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787186 2:45001369-45001391 GGAGCACCAACCCGCGCTGGGGG No data
929787172_929787184 17 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787184 2:45001367-45001389 AAGGAGCACCAACCCGCGCTGGG No data
929787172_929787180 -2 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787172_929787187 22 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787187 2:45001372-45001394 GCACCAACCCGCGCTGGGGGCGG No data
929787172_929787183 16 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787172_929787185 18 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787185 2:45001368-45001390 AGGAGCACCAACCCGCGCTGGGG No data
929787172_929787189 25 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787172_929787178 -6 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787172 Original CRISPR CGGCCGGCTGGTGAGCAGGA AGG (reversed) Intergenic