ID: 929787173

View in Genome Browser
Species Human (GRCh38)
Location 2:45001331-45001353
Sequence CCGGCGGCCGGCTGGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787173_929787193 30 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787173_929787187 18 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787187 2:45001372-45001394 GCACCAACCCGCGCTGGGGGCGG No data
929787173_929787192 27 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787192 2:45001381-45001403 CGCGCTGGGGGCGGAGGTTCAGG No data
929787173_929787184 13 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787184 2:45001367-45001389 AAGGAGCACCAACCCGCGCTGGG No data
929787173_929787189 21 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787173_929787183 12 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787173_929787185 14 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787185 2:45001368-45001390 AGGAGCACCAACCCGCGCTGGGG No data
929787173_929787178 -10 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787173_929787186 15 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787186 2:45001369-45001391 GGAGCACCAACCCGCGCTGGGGG No data
929787173_929787180 -6 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787173 Original CRISPR CCGGCGGCCGGCTGGTGAGC AGG (reversed) Intergenic