ID: 929787175

View in Genome Browser
Species Human (GRCh38)
Location 2:45001337-45001359
Sequence CACCAGCCGGCCGCCGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787168_929787175 4 Left 929787168 2:45001310-45001332 CCAGGAGTTCCTTCTTCCCTTCC No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787163_929787175 19 Left 929787163 2:45001295-45001317 CCCCGACCACCGCGACCAGGAGT No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787167_929787175 10 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787166_929787175 13 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787164_929787175 18 Left 929787164 2:45001296-45001318 CCCGACCACCGCGACCAGGAGTT No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787165_929787175 17 Left 929787165 2:45001297-45001319 CCGACCACCGCGACCAGGAGTTC No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787169_929787175 -5 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data
929787161_929787175 25 Left 929787161 2:45001289-45001311 CCTGGTCCCCGACCACCGCGACC No data
Right 929787175 2:45001337-45001359 CACCAGCCGGCCGCCGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787175 Original CRISPR CACCAGCCGGCCGCCGGCAG CGG Intergenic