ID: 929787176

View in Genome Browser
Species Human (GRCh38)
Location 2:45001339-45001361
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787176_929787184 5 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787184 2:45001367-45001389 AAGGAGCACCAACCCGCGCTGGG No data
929787176_929787185 6 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787185 2:45001368-45001390 AGGAGCACCAACCCGCGCTGGGG No data
929787176_929787186 7 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787186 2:45001369-45001391 GGAGCACCAACCCGCGCTGGGGG No data
929787176_929787193 22 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787176_929787192 19 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787192 2:45001381-45001403 CGCGCTGGGGGCGGAGGTTCAGG No data
929787176_929787189 13 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787176_929787187 10 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787187 2:45001372-45001394 GCACCAACCCGCGCTGGGGGCGG No data
929787176_929787183 4 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787176_929787194 26 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787194 2:45001388-45001410 GGGGCGGAGGTTCAGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787176 Original CRISPR AGCCGCTGCCGGCGGCCGGC TGG (reversed) Intergenic