ID: 929787177

View in Genome Browser
Species Human (GRCh38)
Location 2:45001343-45001365
Sequence CTGGAGCCGCTGCCGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787177_929787194 22 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787194 2:45001388-45001410 GGGGCGGAGGTTCAGGCGGCAGG No data
929787177_929787189 9 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787177_929787195 27 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787177_929787183 0 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787177_929787185 2 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787185 2:45001368-45001390 AGGAGCACCAACCCGCGCTGGGG No data
929787177_929787184 1 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787184 2:45001367-45001389 AAGGAGCACCAACCCGCGCTGGG No data
929787177_929787193 18 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787177_929787192 15 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787192 2:45001381-45001403 CGCGCTGGGGGCGGAGGTTCAGG No data
929787177_929787186 3 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787186 2:45001369-45001391 GGAGCACCAACCCGCGCTGGGGG No data
929787177_929787187 6 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787187 2:45001372-45001394 GCACCAACCCGCGCTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787177 Original CRISPR CTGGAGCCGCTGCCGGCGGC CGG (reversed) Intergenic
No off target data available for this crispr