ID: 929787178

View in Genome Browser
Species Human (GRCh38)
Location 2:45001344-45001366
Sequence CGGCCGCCGGCAGCGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787173_929787178 -10 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787164_929787178 25 Left 929787164 2:45001296-45001318 CCCGACCACCGCGACCAGGAGTT No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787167_929787178 17 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787169_929787178 2 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787172_929787178 -6 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787168_929787178 11 Left 929787168 2:45001310-45001332 CCAGGAGTTCCTTCTTCCCTTCC No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787163_929787178 26 Left 929787163 2:45001295-45001317 CCCCGACCACCGCGACCAGGAGT No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787166_929787178 20 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787171_929787178 -5 Left 929787171 2:45001326-45001348 CCCTTCCTGCTCACCAGCCGGCC No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data
929787165_929787178 24 Left 929787165 2:45001297-45001319 CCGACCACCGCGACCAGGAGTTC No data
Right 929787178 2:45001344-45001366 CGGCCGCCGGCAGCGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787178 Original CRISPR CGGCCGCCGGCAGCGGCTCC AGG Intergenic