ID: 929787180

View in Genome Browser
Species Human (GRCh38)
Location 2:45001348-45001370
Sequence CGCCGGCAGCGGCTCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787168_929787180 15 Left 929787168 2:45001310-45001332 CCAGGAGTTCCTTCTTCCCTTCC No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787173_929787180 -6 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787171_929787180 -1 Left 929787171 2:45001326-45001348 CCCTTCCTGCTCACCAGCCGGCC No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787169_929787180 6 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787165_929787180 28 Left 929787165 2:45001297-45001319 CCGACCACCGCGACCAGGAGTTC No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787167_929787180 21 Left 929787167 2:45001304-45001326 CCGCGACCAGGAGTTCCTTCTTC No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787166_929787180 24 Left 929787166 2:45001301-45001323 CCACCGCGACCAGGAGTTCCTTC No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787172_929787180 -2 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787163_929787180 30 Left 929787163 2:45001295-45001317 CCCCGACCACCGCGACCAGGAGT No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data
929787164_929787180 29 Left 929787164 2:45001296-45001318 CCCGACCACCGCGACCAGGAGTT No data
Right 929787180 2:45001348-45001370 CGCCGGCAGCGGCTCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787180 Original CRISPR CGCCGGCAGCGGCTCCAGGA AGG Intergenic