ID: 929787181

View in Genome Browser
Species Human (GRCh38)
Location 2:45001350-45001372
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787181_929787189 2 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787181_929787196 25 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787196 2:45001398-45001420 TTCAGGCGGCAGGAATGGAGAGG No data
929787181_929787192 8 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787192 2:45001381-45001403 CGCGCTGGGGGCGGAGGTTCAGG No data
929787181_929787185 -5 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787185 2:45001368-45001390 AGGAGCACCAACCCGCGCTGGGG No data
929787181_929787187 -1 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787187 2:45001372-45001394 GCACCAACCCGCGCTGGGGGCGG No data
929787181_929787186 -4 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787186 2:45001369-45001391 GGAGCACCAACCCGCGCTGGGGG No data
929787181_929787193 11 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787181_929787194 15 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787194 2:45001388-45001410 GGGGCGGAGGTTCAGGCGGCAGG No data
929787181_929787183 -7 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787181_929787184 -6 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787184 2:45001367-45001389 AAGGAGCACCAACCCGCGCTGGG No data
929787181_929787195 20 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787181 Original CRISPR CTCCTTCCTGGAGCCGCTGC CGG (reversed) Intergenic