ID: 929787182

View in Genome Browser
Species Human (GRCh38)
Location 2:45001362-45001384
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787182_929787192 -4 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787192 2:45001381-45001403 CGCGCTGGGGGCGGAGGTTCAGG No data
929787182_929787196 13 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787196 2:45001398-45001420 TTCAGGCGGCAGGAATGGAGAGG No data
929787182_929787189 -10 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787182_929787195 8 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787182_929787193 -1 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787182_929787194 3 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787194 2:45001388-45001410 GGGGCGGAGGTTCAGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787182 Original CRISPR CGCGGGTTGGTGCTCCTTCC TGG (reversed) Intergenic