ID: 929787183

View in Genome Browser
Species Human (GRCh38)
Location 2:45001366-45001388
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787171_929787183 17 Left 929787171 2:45001326-45001348 CCCTTCCTGCTCACCAGCCGGCC No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787181_929787183 -7 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787176_929787183 4 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787177_929787183 0 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787173_929787183 12 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787169_929787183 24 Left 929787169 2:45001319-45001341 CCTTCTTCCCTTCCTGCTCACCA No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787179_929787183 -4 Left 929787179 2:45001347-45001369 CCGCCGGCAGCGGCTCCAGGAAG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data
929787172_929787183 16 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787183 2:45001366-45001388 GAAGGAGCACCAACCCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type