ID: 929787189

View in Genome Browser
Species Human (GRCh38)
Location 2:45001375-45001397
Sequence CCAACCCGCGCTGGGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787177_929787189 9 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787182_929787189 -10 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787172_929787189 25 Left 929787172 2:45001327-45001349 CCTTCCTGCTCACCAGCCGGCCG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787181_929787189 2 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787171_929787189 26 Left 929787171 2:45001326-45001348 CCCTTCCTGCTCACCAGCCGGCC No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787176_929787189 13 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787179_929787189 5 Left 929787179 2:45001347-45001369 CCGCCGGCAGCGGCTCCAGGAAG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
929787173_929787189 21 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787189 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929787189 Original CRISPR CCAACCCGCGCTGGGGGCGG AGG Intergenic
No off target data available for this crispr