ID: 929787193

View in Genome Browser
Species Human (GRCh38)
Location 2:45001384-45001406
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787182_929787193 -1 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787176_929787193 22 Left 929787176 2:45001339-45001361 CCAGCCGGCCGCCGGCAGCGGCT No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787173_929787193 30 Left 929787173 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787179_929787193 14 Left 929787179 2:45001347-45001369 CCGCCGGCAGCGGCTCCAGGAAG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787181_929787193 11 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data
929787177_929787193 18 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787193 2:45001384-45001406 GCTGGGGGCGGAGGTTCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type