ID: 929787195

View in Genome Browser
Species Human (GRCh38)
Location 2:45001393-45001415
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929787188_929787195 -5 Left 929787188 2:45001375-45001397 CCAACCCGCGCTGGGGGCGGAGG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787182_929787195 8 Left 929787182 2:45001362-45001384 CCAGGAAGGAGCACCAACCCGCG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787181_929787195 20 Left 929787181 2:45001350-45001372 CCGGCAGCGGCTCCAGGAAGGAG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787179_929787195 23 Left 929787179 2:45001347-45001369 CCGCCGGCAGCGGCTCCAGGAAG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787190_929787195 -9 Left 929787190 2:45001379-45001401 CCCGCGCTGGGGGCGGAGGTTCA No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787177_929787195 27 Left 929787177 2:45001343-45001365 CCGGCCGCCGGCAGCGGCTCCAG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data
929787191_929787195 -10 Left 929787191 2:45001380-45001402 CCGCGCTGGGGGCGGAGGTTCAG No data
Right 929787195 2:45001393-45001415 GGAGGTTCAGGCGGCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type