ID: 929788213

View in Genome Browser
Species Human (GRCh38)
Location 2:45006861-45006883
Sequence CTGGATTTTCAGATCACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 698}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929788206_929788213 16 Left 929788206 2:45006822-45006844 CCTGAAGTTGTGGGGTGAGCCGG 0: 1
1: 0
2: 2
3: 17
4: 164
Right 929788213 2:45006861-45006883 CTGGATTTTCAGATCACTCTAGG 0: 1
1: 0
2: 2
3: 36
4: 698
929788205_929788213 17 Left 929788205 2:45006821-45006843 CCCTGAAGTTGTGGGGTGAGCCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 929788213 2:45006861-45006883 CTGGATTTTCAGATCACTCTAGG 0: 1
1: 0
2: 2
3: 36
4: 698
929788210_929788213 -3 Left 929788210 2:45006841-45006863 CCGGGAGGAAGAGACGATGCCTG 0: 1
1: 0
2: 3
3: 21
4: 221
Right 929788213 2:45006861-45006883 CTGGATTTTCAGATCACTCTAGG 0: 1
1: 0
2: 2
3: 36
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929788213 Original CRISPR CTGGATTTTCAGATCACTCT AGG Intronic
900352582 1:2242726-2242748 CAGGAGTTTCAGACCAGTCTGGG - Intronic
900399980 1:2469055-2469077 CTGTATATTCAGGTCACTCCAGG + Intronic
901139320 1:7018171-7018193 GTGGAGGTTCAGGTCACTCTGGG + Intronic
901320059 1:8334490-8334512 CAGGAGTTTGAGATCAGTCTGGG + Intronic
901550425 1:9992289-9992311 CAGGATTTTGAGATCAGCCTGGG - Intergenic
901918383 1:12518094-12518116 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
902261781 1:15230875-15230897 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
903043562 1:20550139-20550161 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
903102369 1:21042184-21042206 CAGGAGTTTCAGACCAGTCTGGG - Intronic
903243966 1:22002404-22002426 CAGGATTTTGAGACCAGTCTGGG - Intronic
903329787 1:22591427-22591449 CAGGAGTTTCAGATCAGCCTGGG - Intronic
903535137 1:24061798-24061820 CTGGAGTTTGAGACCAGTCTGGG - Intronic
903984566 1:27216714-27216736 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
904175456 1:28625328-28625350 CAGGACTTTCAGGTCAGTCTGGG + Intronic
904737341 1:32644751-32644773 CAGGATTTCCAGATTAGTCTGGG - Intronic
905170260 1:36105737-36105759 CAGGACTTTGAGATCACTCTGGG + Intronic
905960955 1:42041649-42041671 CTGGCTCTTCAGGTCACTGTAGG - Intergenic
906044664 1:42818677-42818699 CAGGATTTCCAGATCACCCTGGG - Intronic
906334415 1:44916434-44916456 CTGGAGTTTGAGATCAGCCTGGG - Intronic
906426005 1:45713217-45713239 CAGGAGTTTGAGATCAGTCTGGG + Intronic
906489402 1:46256285-46256307 CAGGATTTTGAGACCACCCTAGG - Intronic
907015724 1:51011031-51011053 CTGGAGTTTGAGACCAGTCTTGG + Intergenic
907976405 1:59435380-59435402 TTGCATTTTCAGATCCCTCAGGG - Intronic
908423839 1:63985670-63985692 CAGGAGTTTGAGACCACTCTGGG + Intronic
908449558 1:64238831-64238853 CAGGAATTTGAGATCACCCTGGG + Intronic
908768717 1:67576517-67576539 CAGGAGTTTGAGACCACTCTGGG + Intergenic
909236343 1:73156634-73156656 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
909425515 1:75520223-75520245 CTGGATTGCAACATCACTCTGGG - Intronic
909665746 1:78131043-78131065 CAGGATTTTGAGATCAGCCTGGG - Intronic
909819039 1:80035670-80035692 CTGAATTTTTAGATCACTTTGGG + Intergenic
910258706 1:85276097-85276119 CTGGATTGACAGATCACTGGAGG + Intronic
911485914 1:98504838-98504860 CAGGAATTTCAGACCAGTCTGGG + Intergenic
911832570 1:102572136-102572158 TTAGTTTTTCAGATCACCCTTGG + Intergenic
912865742 1:113254829-113254851 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
912982138 1:114384563-114384585 CTGAATTTTTAGGTCAGTCTAGG + Intergenic
913503111 1:119489913-119489935 TAGGAATTTGAGATCACTCTAGG + Intergenic
914383120 1:147138516-147138538 CTGGATTTTGAGACCAGCCTGGG + Intergenic
914734498 1:150402467-150402489 CTGGAGTTTGAGATCAGCCTGGG + Intronic
914945468 1:152061591-152061613 CTGGGTTTTCATATCTCACTTGG + Intergenic
915072667 1:153284053-153284075 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
915615994 1:157038818-157038840 CAGGAGTTTGAGACCACTCTGGG + Intronic
915819231 1:159004263-159004285 CTGGAGTTTGAGATCAGCCTGGG + Intronic
916324143 1:163538214-163538236 CAGGGTTTTCAAATCATTCTGGG - Intergenic
916401942 1:164458799-164458821 CAGGAGTTGAAGATCACTCTGGG + Intergenic
916699370 1:167275233-167275255 CAGGAGTTCAAGATCACTCTGGG - Intronic
917220420 1:172722662-172722684 CAGGAGTTTGAGATCAGTCTAGG + Intergenic
917833153 1:178914594-178914616 CTAGATACTCAGATCTCTCTTGG + Intronic
917952966 1:180060435-180060457 CAGGAGTTTGAGACCACTCTAGG + Intronic
918271425 1:182904953-182904975 CTGGAGTTTGAGAGCAGTCTGGG - Intronic
918710968 1:187729485-187729507 CTGGAGTTTGAGATCAGCCTGGG + Intergenic
920917481 1:210269697-210269719 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
921549070 1:216510958-216510980 CTGGACTTTTAGACCATTCTTGG + Intronic
921611661 1:217219178-217219200 TTGCATTTTCAGATCACACATGG + Intergenic
922103073 1:222490037-222490059 CAGGAGTTTCAGAACAGTCTGGG + Intergenic
922707998 1:227800771-227800793 CAGGAGTTTGAGATCAATCTGGG - Intergenic
922782337 1:228263348-228263370 CTGGAATTTGAGACCAGTCTGGG + Intronic
923273960 1:232380604-232380626 CTGAATTTTCACTTCACACTGGG + Intergenic
923286806 1:232503980-232504002 CAGGAGTTTGAGATCAGTCTGGG + Intronic
923600512 1:235398851-235398873 CTGGAATTTGAGATCAGCCTAGG - Intronic
923607663 1:235459412-235459434 CAGGAGTTTGAGATCACTCTAGG + Intronic
924177419 1:241406426-241406448 CTGGAGTTTGAGATCAGCCTGGG - Intergenic
924489456 1:244521143-244521165 CAGGAGTTTCAGACCAGTCTGGG + Intronic
924555523 1:245115254-245115276 CAGGAGTTTGAGATCAGTCTGGG - Intronic
924802469 1:247337550-247337572 CTGTACTTTCATATCATTCTTGG - Intergenic
924803722 1:247346513-247346535 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1062994141 10:1849168-1849190 CAGGAGTTTGAGACCACTCTGGG + Intergenic
1063078736 10:2744073-2744095 CAGGAATTTGAGATCAGTCTAGG - Intergenic
1063153764 10:3359495-3359517 CAGGAGTTTCAGACCAGTCTGGG - Intergenic
1063659390 10:8023455-8023477 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1063723932 10:8615937-8615959 CAGGAGTTTGAGATCACTCTGGG - Intergenic
1064394348 10:14969236-14969258 CAGGATTTTGAGACCAGTCTGGG + Intronic
1064466309 10:15585618-15585640 CTGGTTTTTCAGAACAATCATGG - Intronic
1064848985 10:19688467-19688489 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1065112865 10:22457036-22457058 CAGGATTTTGAGATCAGCCTGGG - Intergenic
1065337860 10:24673118-24673140 ATGGATTTATAGATCACTTTGGG - Intronic
1065514541 10:26512036-26512058 CAGGATTTTGAGATCAGCCTGGG - Intronic
1065651213 10:27893939-27893961 CTGGAGTTTGAGATCATCCTGGG + Intronic
1065725287 10:28662878-28662900 CAGGAGTTTGAGATCACCCTGGG - Intergenic
1066231017 10:33433196-33433218 CAGGATTTTTAGACCACCCTAGG - Intergenic
1066310681 10:34192724-34192746 CTGGATCTTAAGAACATTCTAGG - Intronic
1066579166 10:36861235-36861257 CTGGAGTTTGAGATCAACCTGGG + Intergenic
1066640916 10:37553332-37553354 CTGCATTAACAGATGACTCTAGG + Intergenic
1067271701 10:44797095-44797117 CAGGATTTTGAGATCAGCCTGGG + Intergenic
1067573990 10:47395729-47395751 CAGGAGTTTGAGATCACCCTGGG - Intergenic
1067900067 10:50230830-50230852 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1068261170 10:54584172-54584194 CAGGAATTTGAGACCACTCTGGG + Intronic
1068670263 10:59715390-59715412 CTGGAGTTTGAGATCAGCCTGGG - Intronic
1068799639 10:61125388-61125410 CAGGAGTTTGAGATCACTCTGGG + Intergenic
1068930052 10:62580588-62580610 CAGGATCTTCAGAAAACTCTTGG + Intronic
1069039871 10:63684392-63684414 CAGGAATTTGAGATCAGTCTGGG + Intergenic
1069418510 10:68224307-68224329 CTGGGATTTGAGACCACTCTGGG - Intergenic
1069563686 10:69449615-69449637 CAGGAGTTTCAGACCAGTCTGGG - Intergenic
1069922165 10:71822334-71822356 GTGTCTTTTCAGGTCACTCTAGG + Intronic
1070333268 10:75432681-75432703 TTGGATTTTGAGATTACTTTGGG + Intronic
1071532042 10:86397557-86397579 CAGGATTTTGAGACCACTCTTGG + Intergenic
1071728884 10:88227996-88228018 CTAGATTTTTACATCTCTCTTGG + Intergenic
1071827078 10:89336065-89336087 CAGGAGTTTGAGACCACTCTGGG + Intronic
1072159371 10:92752172-92752194 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1072185759 10:93037346-93037368 CAGGAGTTTCAGAACAATCTGGG - Intronic
1072606661 10:96989746-96989768 CAGGAGTTTCAGATCAGCCTCGG - Intergenic
1072909022 10:99483672-99483694 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1073182385 10:101592509-101592531 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1073330724 10:102668513-102668535 CGGGATTTTCTGCTGACTCTGGG - Intergenic
1073932249 10:108589135-108589157 CAGGAGTTTCAGACCAGTCTGGG + Intergenic
1074050679 10:109878677-109878699 CAGGAGTTTCAGATCAGCCTGGG + Intronic
1074106555 10:110393477-110393499 CCGTATTTTCACATCACTGTGGG + Intergenic
1074272366 10:111967108-111967130 GTGGATAGTCAGATCACTCTTGG + Intergenic
1074295134 10:112179758-112179780 CTGGATGTTAAGCTCTCTCTGGG - Intronic
1074429839 10:113385192-113385214 CTTGATTTGCAGCTCACTCTTGG + Intergenic
1074551430 10:114445978-114446000 CTGGAGTTTGAGATCAGCCTGGG - Intronic
1074733411 10:116401724-116401746 CTGTATTTTCTTATCTCTCTGGG - Intergenic
1077237849 11:1490689-1490711 CAGGAGTTTCAGATCAGCCTGGG + Intronic
1077260278 11:1614720-1614742 CAGGATTTTGAGACCAGTCTAGG + Intergenic
1077493598 11:2874048-2874070 CAGGATTTTCAGACCAGCCTGGG - Intergenic
1077587492 11:3464965-3464987 CAGGATTTTCAGTCCAGTCTGGG - Intergenic
1078828378 11:14953680-14953702 CTGAATTATTTGATCACTCTTGG + Intronic
1079203188 11:18392762-18392784 CTAGATTCTAAGATCACTCTAGG - Intergenic
1079423613 11:20318203-20318225 CAGGAGTTTCAGACCAGTCTGGG + Intergenic
1080411681 11:32030737-32030759 CTGGATTTTCTCTTCCCTCTAGG + Intronic
1081305184 11:41503059-41503081 CTGGATTTTCAGCTCACTGAAGG + Intergenic
1081599615 11:44484137-44484159 CCGGCTTTTCAGCTCAGTCTGGG + Intergenic
1081935094 11:46898777-46898799 CTGGATTTTCTGGTCCCTCTTGG - Intronic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1083432744 11:62622807-62622829 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1084340229 11:68493688-68493710 CTGGAGTTTGAGACCACCCTGGG - Intronic
1084649290 11:70479322-70479344 CTTGATTTTCAAATAACTTTGGG - Intronic
1084662055 11:70551798-70551820 CGGGAGTTTCACATCACTCCAGG - Intronic
1084948584 11:72652318-72652340 CTGGAGTTCCAGATCAGCCTGGG - Intronic
1084960060 11:72711903-72711925 CAGGAGTTTGAGACCACTCTGGG - Intronic
1085666934 11:78422200-78422222 CAGGAGTTTGAGACCACTCTGGG - Intergenic
1086788415 11:91002505-91002527 CGGAAGTTTGAGATCACTCTGGG + Intergenic
1088480868 11:110296038-110296060 CTGGATTTTCAAACAACCCTTGG + Intronic
1089277365 11:117346653-117346675 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1089393098 11:118115328-118115350 CTGGGTTTTCTCATCTCTCTAGG - Intronic
1090278451 11:125435869-125435891 CAGGATTTTAAGACCAGTCTGGG + Intergenic
1090533877 11:127619483-127619505 CAGGATTTTGAGATCAGCCTGGG + Intergenic
1091426344 12:393320-393342 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1091736474 12:2926289-2926311 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1091746036 12:2993684-2993706 CAGGAGTTTCAGACCAGTCTAGG - Intronic
1091819360 12:3463487-3463509 CTGGATTTCCATTTTACTCTTGG + Intronic
1092190979 12:6520537-6520559 CAGGAATTTGAGATCAGTCTGGG - Intronic
1092463884 12:8710917-8710939 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1092473554 12:8799496-8799518 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1092697970 12:11194798-11194820 CAGGACTTTCAGACCAGTCTAGG - Intergenic
1092791522 12:12074849-12074871 CTGGATTTGGAGACCAGTCTAGG - Intronic
1093206206 12:16253660-16253682 CAGGATTTTGAGATCAGCCTAGG + Intronic
1093446964 12:19271294-19271316 CAGGATTTTGAGATCAGCCTGGG + Intronic
1093454625 12:19352994-19353016 CAGGATTTTCAGACCAGCCTGGG - Intronic
1094357973 12:29598458-29598480 CTGAATCTATAGATCACTCTGGG + Intronic
1095136827 12:38615082-38615104 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1095396782 12:41770884-41770906 CTGGAGTTTGAGATCAGCCTGGG + Intergenic
1095479638 12:42621773-42621795 CATGATTTTCAGATCACATTAGG - Intergenic
1095747762 12:45678363-45678385 CAGGAGTTTCAGATCAGCCTAGG + Intergenic
1096138717 12:49224743-49224765 CAGGAGTTTGAGATCACCCTGGG - Intronic
1096863315 12:54546013-54546035 CAGGAGTTTGAGACCACTCTGGG + Exonic
1097035761 12:56122421-56122443 ATGGATTTTCAGGTCAAACTAGG - Exonic
1097417503 12:59329873-59329895 CTAGATATACAGATCAGTCTAGG + Intergenic
1097657748 12:62388918-62388940 CAGGATTTTGAGACCATTCTGGG + Intronic
1097862100 12:64528048-64528070 CAGGAGTTTGAGACCACTCTAGG + Intergenic
1097940415 12:65298210-65298232 CAGGAGTTTGAGACCACTCTGGG - Intronic
1098593996 12:72249476-72249498 CTGGAGTTTCAGATCAGCCTGGG + Intronic
1098891380 12:76013147-76013169 CGGGAGTTTGAGACCACTCTGGG + Intergenic
1099169117 12:79342437-79342459 CAGGATTTTGAGACCAGTCTGGG - Intronic
1099195575 12:79610707-79610729 CTTGAGTTTGAGATCACCCTGGG + Intronic
1100228786 12:92586351-92586373 CAGGATTTTCAGACCAGCCTGGG + Intergenic
1100265316 12:92970228-92970250 CAGGAGTTTCAGATCAGCCTAGG + Intergenic
1100358977 12:93858855-93858877 CTGGCTGTTCAGATCCTTCTTGG - Intronic
1101684900 12:107009328-107009350 CAGGAGTTTGAGACCACTCTGGG + Intronic
1101873990 12:108587066-108587088 CAGGATTTTGAGACCAGTCTGGG - Intergenic
1101905234 12:108819753-108819775 CAGGAGTTTGAGATCACCCTGGG + Intronic
1101917271 12:108905404-108905426 CTGGATTTTCAGTGAATTCTTGG + Intergenic
1102023826 12:109701856-109701878 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1102079699 12:110087813-110087835 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1102269863 12:111523852-111523874 CAGGAGTTCCAGATCACCCTGGG + Intronic
1102273230 12:111558587-111558609 CCGGAGTTTGAGATCAGTCTGGG + Intronic
1102441437 12:112966850-112966872 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1103501707 12:121408095-121408117 CTGGAGTTTGAGATCAGCCTGGG + Intronic
1103718000 12:122957250-122957272 CAGGAGTTTGAGACCACTCTGGG - Intronic
1103804396 12:123561064-123561086 CTGGAGTTCCAGACCAGTCTGGG - Intergenic
1105456618 13:20546925-20546947 CTGATTTTTCTGATCACTTTGGG + Intergenic
1105488549 13:20862534-20862556 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1105612016 13:21976981-21977003 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1105641863 13:22273757-22273779 CTGCATCTTCAGGTCACTCTGGG - Intergenic
1105660306 13:22487093-22487115 CTGGATTTACAGATGTCTCCTGG + Intergenic
1105730217 13:23206889-23206911 CTGAATCTACAGATCACTTTTGG - Intronic
1107167975 13:37305420-37305442 CAGGAATTTAAGATCAGTCTGGG - Intergenic
1108019644 13:46113897-46113919 CAGGATTTTGAGATCAGACTGGG - Intergenic
1109744028 13:66597188-66597210 CTGGGTCTGCAGATCACTTTGGG - Intronic
1110206026 13:72914786-72914808 CAGGAGTTTGAGATCACTCTAGG - Intronic
1110415880 13:75251769-75251791 CAGGAGTTTCAGACCAGTCTGGG - Intergenic
1111245896 13:85540717-85540739 CTGGATTATCTAAACACTCTTGG + Intergenic
1111340344 13:86877282-86877304 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1111448729 13:88386464-88386486 CAGAATTTTCAGAACTCTCTTGG - Intergenic
1112797481 13:103072100-103072122 CGGGAGTTTGAGACCACTCTGGG - Intergenic
1113790743 13:113026741-113026763 CTGGATTTTCTGGTACCTCTGGG - Intronic
1114212497 14:20627010-20627032 CAGGAGTTCCAGATCACCCTGGG - Intergenic
1114337933 14:21712331-21712353 ATGGCTTTGCAGAGCACTCTGGG + Intergenic
1114516706 14:23304785-23304807 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1114752621 14:25222713-25222735 CTTTATTTTCAGAGAACTCTGGG - Intergenic
1114838982 14:26239943-26239965 CTGGGTTTTTAAATGACTCTGGG + Intergenic
1114935103 14:27525438-27525460 CTGACTTTGCAGATCACTTTGGG + Intergenic
1115402433 14:32977521-32977543 CAGGAGTTTGAGATCAATCTGGG + Intronic
1116321360 14:43468704-43468726 CTAGACTTTTAGATCATTCTTGG - Intergenic
1117020721 14:51567546-51567568 CTGGAGTTTGAGATCAGCCTGGG - Intronic
1117146580 14:52842049-52842071 CAGGATTTTCAGACCAGCCTGGG - Intergenic
1118238399 14:64032957-64032979 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1118240218 14:64049119-64049141 CTGGATTTTAACATGATTCTTGG + Intronic
1118411884 14:65488028-65488050 CAGGAGTTTCAGACCAGTCTGGG - Intronic
1118557972 14:67047572-67047594 CAGGAGTTTGAGACCACTCTGGG - Intronic
1119024872 14:71144584-71144606 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1119219807 14:72897310-72897332 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1119673913 14:76539489-76539511 TTGGATGTTCAGTTGACTCTTGG + Intergenic
1120121236 14:80681893-80681915 CAGGATTTTGAGACCAGTCTGGG + Intronic
1120567973 14:86082777-86082799 TTGCATTTTCAGCTTACTCTAGG + Intergenic
1120769678 14:88365345-88365367 CTGGTTTTTCAGATTCCTTTGGG + Intergenic
1120800725 14:88685656-88685678 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1120974659 14:90237992-90238014 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1121114553 14:91334658-91334680 CTGGATTTTCATATAAACCTGGG + Intronic
1122121579 14:99556733-99556755 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1122195388 14:100081069-100081091 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1122514345 14:102296709-102296731 CAGGATTTTGAGACCAGTCTAGG + Intronic
1202891169 14_KI270722v1_random:159417-159439 CAGGAATTTGAGACCACTCTGGG + Intergenic
1124546390 15:30631450-30631472 CAGGATTTTGAGACCAGTCTGGG + Intronic
1124779918 15:32620855-32620877 CAGGATTTTGAGACCAGTCTGGG + Intronic
1124826226 15:33098549-33098571 CTGGATTTGAACATCACTGTAGG - Intronic
1124937282 15:34185176-34185198 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1125175059 15:36811550-36811572 CTGCATTTTCTCATTACTCTTGG + Intergenic
1125318229 15:38454821-38454843 ATAGTTTTTCAGATTACTCTTGG + Intronic
1125701807 15:41693046-41693068 CAGGAGTTTGAGACCACTCTGGG - Intronic
1126620054 15:50629479-50629501 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1126635032 15:50771680-50771702 CAGGATTTTAAGATCAGCCTGGG + Intergenic
1127640570 15:60912200-60912222 CAGGAGTTTCAGACCAGTCTGGG + Intronic
1127953264 15:63831313-63831335 CAGGAGTTTAAGATCAGTCTGGG - Intronic
1128053022 15:64680271-64680293 CTGGATTTACAAGTCACACTGGG - Exonic
1128102007 15:65009860-65009882 CTGGAGTTCCAGACCAGTCTGGG - Intronic
1129130142 15:73486416-73486438 CTGGCTTTTCAGCTCCCTTTGGG + Intronic
1129414233 15:75366429-75366451 CGGGCTTATGAGATCACTCTGGG + Intronic
1129863221 15:78879727-78879749 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1130026664 15:80276486-80276508 CTGGATATTCAGCTCTCCCTTGG + Intergenic
1130743454 15:86625806-86625828 CTGGATTCTCAGCTGCCTCTAGG - Intronic
1131142496 15:89988726-89988748 CTGGACTTTGAGACCAATCTGGG + Intergenic
1131276599 15:90987063-90987085 CAGGAGTTTCAGATCATTCTGGG + Intronic
1131533592 15:93215250-93215272 CAGGAGTTTGAGATCACCCTGGG - Intergenic
1131852980 15:96562465-96562487 CTCTATTTTCAGATTACTTTAGG - Intergenic
1132460985 16:54456-54478 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1132730631 16:1359771-1359793 TTGAATCTGCAGATCACTCTGGG + Intronic
1133333525 16:4991350-4991372 CAGGAATTTCAGAGCAGTCTAGG + Intronic
1134257031 16:12621072-12621094 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1135333769 16:21583776-21583798 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1135648406 16:24184245-24184267 CTTGAGTTTGAGATCAGTCTGGG + Intronic
1135684529 16:24487858-24487880 CAGGAGTTTGAGATCACCCTGGG - Intergenic
1135731548 16:24899024-24899046 CTGGAGTTTGAGATCAGCCTGGG - Intronic
1135766796 16:25184727-25184749 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1135789626 16:25381801-25381823 CAGGAATTTCAGATCAGCCTGGG - Intergenic
1135857136 16:26022175-26022197 CAGGATTTTGAGATCAGCCTGGG - Intronic
1135981221 16:27148946-27148968 CAGGAGTTTCAGACCACCCTGGG + Intergenic
1136508168 16:30719720-30719742 CAGGAATTTGAGATCACCCTAGG - Intronic
1136673236 16:31876425-31876447 CAGGAGTTTGAGACCACTCTGGG - Intronic
1136789887 16:32960723-32960745 CTGGATTTTACAATAACTCTAGG - Intergenic
1136879925 16:33893213-33893235 CTGGATTTTACAATAACTCTAGG + Intergenic
1137284764 16:47006331-47006353 CAGGATTTTGAGATCAGCCTGGG - Intergenic
1137320751 16:47379364-47379386 CTGTTTTCTCAGATCACTTTTGG - Intronic
1137701443 16:50500948-50500970 CAGGATTTTGAGATCACCCTGGG - Intergenic
1137906022 16:52322837-52322859 ATGGTAATTCAGATCACTCTTGG - Intergenic
1138691798 16:58775637-58775659 CAGGAGTTCCAGACCACTCTGGG - Intergenic
1138959967 16:62017470-62017492 CAGGAGTTTAAGATCAGTCTGGG + Intronic
1139597216 16:67965209-67965231 CTGGGTTTTCAGATTTTTCTTGG - Intronic
1139625345 16:68184195-68184217 CTGTATATTCAAAACACTCTTGG - Intronic
1139771778 16:69283167-69283189 CAGGATTTTGAGACCAATCTGGG - Intronic
1139895346 16:70284001-70284023 CTGGAGTTTGAGACCACCCTGGG + Intronic
1139902299 16:70337703-70337725 CAGGAGTTCCAGATCATTCTGGG + Intronic
1140195954 16:72855610-72855632 CTCGATTTCCAGATGAATCTTGG - Intronic
1140807554 16:78546916-78546938 CAGGGGTTTCAGATCAGTCTGGG + Intronic
1140846800 16:78897017-78897039 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1141761882 16:86033998-86034020 CCTGACTTTCAGATCACCCTGGG + Intergenic
1141881008 16:86859318-86859340 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1142315299 16:89340776-89340798 CTGGGGTTTCAGAGCTCTCTGGG - Intronic
1142430108 16:90021656-90021678 CAGGAGTTTGAGACCACTCTGGG + Intronic
1203092090 16_KI270728v1_random:1222183-1222205 CTGGATTTTACAATAACTCTAGG - Intergenic
1142788693 17:2245886-2245908 CAGGATTTTGAGACCAGTCTGGG - Intronic
1143031779 17:3971969-3971991 CAGGAGTTTCAGACCACGCTGGG + Intergenic
1143176507 17:4958518-4958540 CAGGAGTTTGAGATCAGTCTAGG - Intergenic
1143556614 17:7665835-7665857 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1143768575 17:9153236-9153258 CAGGAGTTTGAGATCATTCTGGG + Intronic
1143835479 17:9688895-9688917 CGGGAGTTCAAGATCACTCTAGG - Intronic
1144699778 17:17329470-17329492 ACGGATTTTCAAATCTCTCTAGG - Intronic
1146441975 17:32905136-32905158 ATGGAGTTTGAGCTCACTCTCGG - Intergenic
1147309104 17:39583738-39583760 CAGGAGTTTCAGACCAGTCTGGG - Intergenic
1147645494 17:42031241-42031263 CTGGAGTTTGAGACCAGTCTGGG - Intronic
1148007806 17:44448347-44448369 CTGGAGTTCCAGACCAATCTAGG + Intronic
1148179185 17:45591325-45591347 CAGGAGTTCCAGAGCACTCTTGG + Intergenic
1148269985 17:46255175-46255197 CAGGAGTTCCAGAGCACTCTTGG - Intergenic
1148527897 17:48359812-48359834 CAGGAGTTTGAGATCAATCTGGG - Intronic
1148529638 17:48377363-48377385 CAGGAATTTCAGACCAGTCTGGG + Intronic
1148691576 17:49530095-49530117 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1149484557 17:57032091-57032113 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1149628648 17:58100227-58100249 CAGGAGTTTCAGACCAGTCTGGG - Intergenic
1149752660 17:59160943-59160965 CAGGAGTTTGAGACCACTCTGGG - Intronic
1149907252 17:60537731-60537753 CAGGAGTTTGAGATCAATCTGGG - Intergenic
1150242120 17:63642964-63642986 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1150665593 17:67133721-67133743 CAGGAGTTTGAGATCACCCTGGG - Intronic
1150679907 17:67276375-67276397 CAGGATTTCGAGATCACCCTGGG - Intergenic
1150963237 17:69937755-69937777 CAGGAGTTTGAGATCAATCTGGG + Intergenic
1151469812 17:74311080-74311102 CTGGAGTTTCAGACCAGCCTGGG - Intronic
1152752515 17:82070468-82070490 CAGGAGTTTGAGACCACTCTGGG - Intergenic
1156031909 18:32722749-32722771 CTGGATTTTGAGACCAGCCTGGG + Intronic
1156148240 18:34212759-34212781 CTGGATGCTGAGACCACTCTTGG - Intronic
1156216856 18:35007881-35007903 CTGTATTTTCAGTTTACTTTTGG - Intronic
1156970266 18:43145699-43145721 CAGGAGTTTCAGATCAGCCTAGG + Intergenic
1158021499 18:52847369-52847391 CTGGATTTTCAGGTGGCTCATGG + Intronic
1158522392 18:58182688-58182710 CAGGAGTTTGAGACCACTCTGGG - Intronic
1158612318 18:58952612-58952634 CTGGAGTTTGAGACCAGTCTGGG - Intronic
1158708371 18:59815108-59815130 CTGGAATTTCCCATCATTCTTGG - Intergenic
1159810632 18:73014320-73014342 CAGGAGTTTGAGATCAGTCTTGG + Intergenic
1160012610 18:75117177-75117199 CTGGGATTTCAGATGGCTCTTGG + Intergenic
1160736816 19:666749-666771 CAGGAGTTGGAGATCACTCTGGG - Intergenic
1161184753 19:2909734-2909756 CAGGAGTTTCACATCACCCTGGG - Intronic
1161844525 19:6704945-6704967 CTGGAGTTTGAGAGCAGTCTGGG - Intronic
1162319257 19:9961051-9961073 GTGGATGTTCAGGTGACTCTTGG - Intronic
1162832092 19:13291588-13291610 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1162971771 19:14184989-14185011 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1163021726 19:14484807-14484829 TAGGAGTTTGAGATCACTCTGGG - Intronic
1163176084 19:15564822-15564844 CAGGAGTTTGAGACCACTCTGGG - Intergenic
1163505083 19:17700826-17700848 CAGGATTTTGAGATCAGCCTGGG + Intergenic
1164145072 19:22507449-22507471 CTGGAGTTTCAGAGCAGGCTGGG - Intronic
1164531406 19:29050988-29051010 CTTGAATTTCAGATTCCTCTTGG - Intergenic
1164698019 19:30261489-30261511 CTGGAGTTTGAGACCAATCTGGG + Intronic
1164789267 19:30962061-30962083 CAGGATATTCACATCACCCTTGG + Intergenic
1164793643 19:31008795-31008817 CTGGAGTTTCAGATCAGGCTGGG - Intergenic
1164819374 19:31233892-31233914 TTGCATTTTCAGATCAGTTTAGG + Intergenic
1165032176 19:33006086-33006108 CAGGAATTTGAGATCAGTCTGGG - Intronic
1165861810 19:38912987-38913009 CAGGAGTTTCAGACCAGTCTAGG - Intergenic
1165889693 19:39103616-39103638 CAGGAGTTTCAGACCAGTCTGGG + Intronic
1166698535 19:44868152-44868174 CAGGAGTTTCAGACCACTCTGGG + Intronic
1167135322 19:47612204-47612226 CTGGATTTTAAGACCAGCCTAGG + Intronic
1167591852 19:50408589-50408611 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1167657177 19:50772401-50772423 CAGGAGTTTGAGACCACTCTGGG - Intergenic
1167700643 19:51042949-51042971 CAGGAGTTTGAGACCACTCTGGG + Intergenic
1167838077 19:52091270-52091292 CTGAATTTGCAGATCACTTTTGG - Intronic
1168119998 19:54246615-54246637 CAGGAGTTTCAGAGGACTCTGGG - Intronic
1202666590 1_KI270708v1_random:126255-126277 CAGGAGTTTGAGACCACTCTGGG + Intergenic
926039470 2:9661310-9661332 ATAGATTTTCAGTTCTCTCTTGG + Intergenic
926240641 2:11082190-11082212 CAGGAGTTTGAGACCACTCTGGG - Intergenic
926475642 2:13318577-13318599 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
926584426 2:14670469-14670491 CTAGCTTTTTAAATCACTCTAGG + Intergenic
926685272 2:15693117-15693139 CAGGATTTTGAGATCAGCCTGGG + Intronic
926794062 2:16604364-16604386 CTGGCTTTGCAGAGCACTGTGGG - Intronic
927109255 2:19852395-19852417 CTGTATGATCATATCACTCTTGG - Intergenic
927143204 2:20143551-20143573 CAGGATTTTCAGGTCTCTATGGG - Intergenic
927550768 2:23997128-23997150 CAGGAATTCCAGATCAATCTAGG - Intronic
927618454 2:24624797-24624819 GTGGATTTTGAGCTGACTCTTGG + Intronic
927655208 2:24939454-24939476 CAGGAGTTCAAGATCACTCTGGG - Intergenic
928326610 2:30324230-30324252 CAGGATTTTGAGACCAGTCTGGG - Intergenic
928742145 2:34367907-34367929 CTGGATTTTCAGATCTACATTGG + Intergenic
929788213 2:45006861-45006883 CTGGATTTTCAGATCACTCTAGG + Intronic
930185653 2:48410103-48410125 CAGGAATTTCAGACCAGTCTAGG - Intergenic
931336615 2:61351012-61351034 CAGGAGTTTCAGATCAGTCTGGG + Intronic
931541327 2:63332815-63332837 CAGGAGTTCCAGATCAGTCTGGG - Intronic
931568150 2:63638579-63638601 CTGGATTATGAGACCAGTCTGGG + Intronic
932649259 2:73537796-73537818 CTGGAGTTTGAGATCAGCCTGGG + Intronic
932670074 2:73729262-73729284 CAGGATTTTGAGACCAATCTGGG + Intronic
932977110 2:76616050-76616072 CAGGAGTTCCAGATCAGTCTGGG + Intergenic
933076138 2:77929076-77929098 CTGAATCTACAGATCACTCTGGG + Intergenic
933249486 2:80012953-80012975 CTGGAGTTTGAGACCATTCTGGG + Intronic
933372039 2:81426946-81426968 CAGGATTTTGAGACCAGTCTAGG - Intergenic
933821175 2:86113595-86113617 CGGGACTTTGAGATCAGTCTGGG + Intronic
934071680 2:88389992-88390014 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
934073033 2:88403029-88403051 CAGGAATTTGAGATCACCCTGGG + Intergenic
934080097 2:88460352-88460374 CAGGAGTTTCAGATCAGCCTGGG - Intergenic
936441267 2:112555430-112555452 CAGGAGTTTGAGATCAATCTGGG + Intronic
936784102 2:116072489-116072511 CAGGAGTTTGAGATCACCCTGGG + Intergenic
937568439 2:123326899-123326921 CTGAATCTGTAGATCACTCTTGG - Intergenic
937897145 2:126986346-126986368 CTGGAATTTAAGAACACTTTTGG + Intergenic
937899678 2:127009574-127009596 CTGAATTTGTAGATCACTTTGGG + Intergenic
938208017 2:129440126-129440148 CTGCTTTGTCAGCTCACTCTGGG + Intergenic
938423291 2:131161857-131161879 CAGAATTTTTAGATCACTTTGGG + Intronic
939018214 2:136926482-136926504 CAGGATTTTGAGACCAGTCTGGG + Intronic
939959252 2:148551753-148551775 CAGGAGTTTCAGACCACCCTGGG + Intergenic
940146223 2:150547097-150547119 CAGGACTTTGAGATCAGTCTGGG - Intergenic
941070199 2:160946735-160946757 CAGGAGTTTGAGACCACTCTGGG + Intergenic
941545895 2:166850881-166850903 CTGAATTTTTAGATCACTTTGGG - Intergenic
941617692 2:167739880-167739902 CAGGAGTTTGAGACCACTCTGGG + Intergenic
941863108 2:170305794-170305816 CAGGAGTTTGAGATCACCCTAGG - Intronic
942169056 2:173271749-173271771 ATGGATTCTCACATCACTTTGGG - Intergenic
942652014 2:178179119-178179141 CTGGACTTTGAGATCAGCCTGGG + Intergenic
942675143 2:178418532-178418554 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
942909731 2:181228498-181228520 CAGGAGTTTCAGATCAGTGTGGG + Intergenic
944452848 2:199860493-199860515 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
945022596 2:205589077-205589099 CAGGAGTTTCAGACCAGTCTGGG + Intronic
945777117 2:214118780-214118802 CTGAATTTGTAGATCACTTTGGG - Intronic
945880411 2:215319329-215319351 CAGGAGTTTAAGATCACCCTGGG + Intronic
946843753 2:223841005-223841027 CGGGAGTTTGAGATCAGTCTGGG + Intergenic
947100901 2:226620403-226620425 CAGGATTTTGAGATCAGCCTGGG + Intergenic
947204621 2:227648996-227649018 CAGGATTTCCAGAACAATCTAGG + Intergenic
1168828747 20:832797-832819 CAGGAGTTTAAGATCAGTCTGGG + Intergenic
1168990810 20:2094731-2094753 CTGGATTTTCAGAGGGCTCCAGG - Intergenic
1170226206 20:13994648-13994670 CTGGATTTTCAGAACCCGCCAGG + Intronic
1170642255 20:18164833-18164855 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1170663840 20:18367938-18367960 CAGGAGTTTCAGATCAGCCTGGG - Intergenic
1170772007 20:19341074-19341096 CTGTATTTTCAGAACTCTCTGGG - Intronic
1170798487 20:19570553-19570575 CTGCATTTTCTGGTGACTCTGGG + Intronic
1172110989 20:32544764-32544786 CTGGATTTTGAGTTCACCCTGGG - Intronic
1172417196 20:34779300-34779322 CAGGAGTTTGAGATCACCCTGGG + Intronic
1172460054 20:35110908-35110930 CAGGAGTTTGAGACCACTCTGGG + Intergenic
1172647557 20:36480493-36480515 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1172922889 20:38501401-38501423 CAGGAGTTTGAGACCACTCTGGG + Intronic
1172941937 20:38659962-38659984 CTGGAGTTTGAGACCACCCTGGG + Intergenic
1172980180 20:38935652-38935674 CAGGAGTTTGAGACCACTCTGGG - Intronic
1173244758 20:41328816-41328838 CAGGATTTTGAGATCAACCTGGG - Intergenic
1173560695 20:44003395-44003417 CAGGAGTTTGAGACCACTCTGGG - Intronic
1173993711 20:47322067-47322089 CTGGAGTTTGAGACCAGTCTGGG - Intronic
1174382928 20:50168938-50168960 CTGGAGTTTGAGATCAGCCTGGG - Intergenic
1174630940 20:51956541-51956563 CAGGATTTTAAGATCAGCCTGGG - Intergenic
1174672790 20:52323647-52323669 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1174902988 20:54520568-54520590 CAGGAGTTTAAGACCACTCTGGG + Intronic
1178041674 21:28646651-28646673 CTGGATTTGGAGATCACTAAAGG + Intergenic
1178385369 21:32144622-32144644 CTGTTTTTTCAGATCCTTCTTGG - Intergenic
1179530779 21:42017786-42017808 CTGGAATTTTAAATGACTCTTGG + Intergenic
1180838730 22:18947850-18947872 CAGGAGTTTCAGATCAACCTGGG - Intergenic
1181063456 22:20293288-20293310 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1181320164 22:21998275-21998297 CTGTGTGTTCAGATCCCTCTTGG - Intergenic
1181552801 22:23650380-23650402 CAGGAGTTTCAGACCACCCTGGG - Intergenic
1182323285 22:29492259-29492281 CAGGATTTTGAGATCAGCCTGGG + Intergenic
1183133288 22:35860752-35860774 CTGAATCTACAGATCACTTTGGG + Intronic
1183178794 22:36244663-36244685 CTGGATTTTCAGATTCCCCAGGG + Intergenic
1183525615 22:38320769-38320791 CAGGAGTTTCAGACCAGTCTGGG - Intronic
1183542925 22:38440199-38440221 CAGGAGTTTCAGATCAGCCTCGG + Intronic
1183769315 22:39910203-39910225 CTGCATCCTCAGATCACTCCTGG - Intronic
1183847843 22:40557560-40557582 CAGGAGTTCCAGATCAGTCTCGG + Intronic
1183992347 22:41606151-41606173 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1184020211 22:41815856-41815878 CAGGAGTTTGAGATCACCCTAGG - Intronic
1184254593 22:43279916-43279938 GTGGAGTTTCAGATCTCCCTAGG - Intronic
1184539595 22:45111840-45111862 CAGGAATTTGAGACCACTCTGGG - Intergenic
1184625953 22:45730133-45730155 CAGGAATTCCAGATCACCCTGGG + Intronic
1184742447 22:46436837-46436859 CAGGCTTTGCAGATCACTCAGGG + Intronic
1185021370 22:48378483-48378505 CTGGATTTGGAGATCAGCCTTGG - Intergenic
1185318257 22:50188314-50188336 CTGGAGTTTAAGACCAGTCTGGG - Intronic
950005689 3:9689618-9689640 CAGGAGTTTGAGATCAGTCTGGG + Intronic
950293287 3:11805343-11805365 CTGGAGTTTGAGATCAGCCTGGG - Intronic
950537854 3:13591166-13591188 CTACATTTTCATATTACTCTTGG + Intronic
950733395 3:14982277-14982299 CAGGAGTTGCAGACCACTCTGGG - Intronic
951930164 3:27956135-27956157 CAGGATTTTCAGACCAGCCTGGG - Intergenic
953765828 3:45741273-45741295 CTGGATTTCCACAGCACTCCTGG + Intronic
954011426 3:47642835-47642857 CAGGAGTTTGAGACCACTCTAGG + Intronic
954031669 3:47824498-47824520 CAGGATTTTGAGACCAGTCTGGG - Intronic
954515578 3:51173329-51173351 CAGGAGTTTGAGATCAGTCTGGG - Intronic
954740134 3:52742991-52743013 CAGGAGTTTGAGATCAATCTGGG - Intronic
955096288 3:55801392-55801414 CTGACTTTTCACATCCCTCTTGG - Intronic
955276075 3:57548498-57548520 CTGGAGTTTGAGATCAGACTGGG + Intergenic
956559416 3:70557950-70557972 CTGGATTACCAGATCTTTCTGGG + Intergenic
957089298 3:75713357-75713379 CAGGAGTTTGAGACCACTCTGGG - Intronic
957208501 3:77230290-77230312 CTGGAGTTAGAGATCAATCTGGG - Intronic
957232579 3:77539126-77539148 CTGGAGTTTGAGATCAGCCTGGG - Intronic
957418965 3:79943792-79943814 CTGAATTTGTAGATTACTCTTGG - Intergenic
957545014 3:81625648-81625670 CTGGAGTTTAAGACCACCCTAGG - Intronic
957876701 3:86156095-86156117 CTGAATCTTTAGATCACACTTGG - Intergenic
958194414 3:90224710-90224732 CAGGAGTTTGAGATCACCCTGGG + Intergenic
959057285 3:101580355-101580377 CAGGAATTTCAGACCAGTCTGGG + Intronic
959232060 3:103667122-103667144 CTGTGTTTTCAGCTCACTCAAGG - Intergenic
959292624 3:104493775-104493797 CAGGAATTTCAGATCAGCCTAGG + Intergenic
959331449 3:105010683-105010705 CTGGATTTTCAGTTCCCTAAAGG + Intergenic
959711488 3:109390360-109390382 CAGGAGTTTAAGATCAGTCTGGG + Intergenic
959998450 3:112704345-112704367 TTGAATTTGCAGATCACTTTTGG - Intergenic
960315325 3:116168990-116169012 CAGAATTTTCAGATCACCCTGGG + Intronic
960880445 3:122339642-122339664 CAGGAGTTTGAGATCATTCTGGG + Intronic
961772755 3:129262203-129262225 CTGAATTTTGAGACCAGTCTGGG + Intronic
962044947 3:131747578-131747600 CAGGAGTTTGAGATCAGTCTGGG - Intronic
962744194 3:138385353-138385375 CTGGAGTTTGAGACCAGTCTGGG - Intronic
963795837 3:149630052-149630074 CAGGAGTTTGAGACCACTCTGGG - Intronic
963984851 3:151580133-151580155 CAGGAGTTTGAGATCAGTCTAGG + Intergenic
964987635 3:162764184-162764206 CAGGAGTTTGAGACCACTCTGGG + Intergenic
965156338 3:165062408-165062430 CTGGATTTTTACATCCTTCTAGG - Exonic
965587722 3:170333869-170333891 CAGGATTTTGAGACCACCCTGGG + Intergenic
965664769 3:171081497-171081519 CTAGATTTTCACATCTCCCTAGG + Intronic
965730291 3:171764181-171764203 CAGGAGTTTCAGATCACTCTGGG - Intronic
966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG + Intergenic
967235642 3:187381275-187381297 CAGGAGTTTGAGATCAATCTGGG + Intergenic
967641304 3:191867549-191867571 CAGCATTTTCATACCACTCTGGG + Intergenic
968214931 3:196881154-196881176 CAGGAGTTTGAGACCACTCTGGG - Intronic
968941521 4:3641341-3641363 CAGGAGTTTGAGACCACTCTGGG + Intergenic
971431977 4:26577789-26577811 CTTGATTTTCAGTACACTCCGGG - Intronic
972369220 4:38406589-38406611 CAGGAGTTTCAGACCAGTCTGGG - Intergenic
972697658 4:41463924-41463946 CTGGAGTTTGAGATCAGACTGGG - Intronic
972944737 4:44240545-44240567 CAGGATTTTGAGATCAGCCTGGG - Intronic
974379756 4:61123935-61123957 CAGGACTTTGAGATCAGTCTGGG - Intergenic
974609264 4:64194300-64194322 CTGAAGTTTCAGTTCTCTCTGGG + Intergenic
974751251 4:66144562-66144584 CTGAATTTGTAGATCACTTTGGG - Intergenic
975063229 4:70030415-70030437 CAGGAGTTTCAGAACAGTCTGGG + Intronic
975526969 4:75361576-75361598 CTGAATTTTCAGAGCACTGAAGG + Intergenic
975977135 4:80112362-80112384 CAGGAGTTTGACATCACTCTGGG + Intronic
976144273 4:82026024-82026046 CAGGAGTTTGAGACCACTCTGGG - Intronic
976279283 4:83311098-83311120 CAGGAGTTTGAGACCACTCTGGG + Intronic
976796883 4:88944152-88944174 CAGGAGTTTGAGATCATTCTGGG + Intronic
977155605 4:93569042-93569064 CTGGAAGTTTAGATCTCTCTAGG + Intronic
977352393 4:95904823-95904845 CAGGAGTTTGAGATCACCCTGGG - Intergenic
977514806 4:98007678-98007700 ATTGATTTTAAGATTACTCTTGG - Intronic
977604279 4:98966704-98966726 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
978604871 4:110468321-110468343 CTGGAGTTTGAGATCAGCCTGGG - Intronic
978686828 4:111455189-111455211 CAGGAGTTTGAGATCATTCTGGG + Intergenic
978812856 4:112870854-112870876 CTGAATTTGTAGATCACTTTGGG + Intronic
979221044 4:118225233-118225255 CAGCATATTCAGATGACTCTGGG + Intronic
979370634 4:119881881-119881903 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
979723293 4:123929273-123929295 TTGGATTTCCAGATCAATTTAGG - Intergenic
980718259 4:136657047-136657069 CAGGAGTTTCAGACCACTCTGGG - Intergenic
981011621 4:139931126-139931148 CTGCATTTTCATTTCACACTGGG - Intronic
981106627 4:140889089-140889111 CAGGAGTTTCAGACCACCCTGGG - Intronic
981591866 4:146373262-146373284 CAGGATTTTAAGATCAGCCTGGG + Intronic
981727519 4:147862643-147862665 CTGGATTTTCAGAACATTAAGGG + Intronic
981971103 4:150662756-150662778 CTGGAGTTTGAGACCAGTCTGGG + Intronic
982047673 4:151464996-151465018 CAGGAATTTGAGACCACTCTGGG + Intronic
982313732 4:154010633-154010655 TTGGCTTTTCAGATCAGTCAGGG - Intergenic
982367820 4:154599248-154599270 CAGGAGTTCCAGATCATTCTGGG - Intergenic
982822653 4:159962687-159962709 CTGAATTTTTAGATCACTTTGGG + Intergenic
983469918 4:168143479-168143501 GTGGATTTTCAGTTGAGTCTAGG - Intronic
983698470 4:170561746-170561768 CAGGAGTTTGAGACCACTCTCGG + Intergenic
983703880 4:170633537-170633559 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
984038439 4:174698395-174698417 CAGGAGTTTGAGATCACCCTGGG - Intronic
984243000 4:177240621-177240643 CAGGAGTTTGAGATCAGTCTAGG - Intergenic
984455876 4:179967086-179967108 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
984780807 4:183524259-183524281 CAGGATTTCGAGACCACTCTGGG - Intergenic
985275008 4:188229653-188229675 CAGGAGTTTGAGATCACCCTGGG + Intergenic
985479444 5:99310-99332 CTGAATTTATAGATCACTTTAGG + Intergenic
987177906 5:15335382-15335404 CAGGAGTTTGAGACCACTCTGGG - Intergenic
988137065 5:27187498-27187520 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
988576203 5:32427564-32427586 CTGAATTTTTAGATCACTTTGGG - Intronic
988668580 5:33356991-33357013 CAGGAGTTTGAGATCACCCTGGG - Intergenic
989040645 5:37224991-37225013 CAGGAGTTTGAGATCAGTCTGGG - Intronic
989289704 5:39748768-39748790 CAGGAGTTTGAGACCACTCTGGG + Intergenic
989339681 5:40359409-40359431 CTGGATATTTATATCACTCCTGG + Intergenic
989607504 5:43258649-43258671 CTGGAGTTTGAGACCAGTCTGGG - Intronic
989632335 5:43498269-43498291 CTGGATATTGAGTTCCCTCTGGG + Intronic
990457863 5:56005395-56005417 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
990574552 5:57111798-57111820 CAGGAGTTTGAGATGACTCTGGG + Intergenic
990664608 5:58057691-58057713 CTGAATTTGTAGATCACTTTGGG + Intergenic
991688260 5:69201648-69201670 CTGGAGTTCCAGACCAGTCTGGG + Intronic
992028332 5:72693620-72693642 TTGCATTTTCAGATCACCCGAGG + Intergenic
992205320 5:74425252-74425274 CAGGAATTTGAGACCACTCTGGG - Intergenic
992230788 5:74661603-74661625 CAGGAGTTTGAGATCAGTCTAGG - Intronic
992312601 5:75516372-75516394 CAGGAGTTTCAGACCAGTCTGGG + Intronic
993239536 5:85363554-85363576 TTGAATTTTAAGATCACTTTGGG + Intergenic
993353233 5:86875775-86875797 CAGTAGTTTCAGATCACCCTGGG + Intergenic
993483352 5:88451680-88451702 CAGGAGTTCCAGATCAGTCTGGG + Intergenic
994835243 5:104843710-104843732 CAGGATTTCCAGACCACCCTGGG - Intergenic
994855901 5:105118588-105118610 CTGGACTTTGAGATCAGCCTGGG - Intergenic
994914863 5:105962294-105962316 CAGGAGTTTGAGATCACCCTGGG - Intergenic
996576452 5:124981685-124981707 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
996739604 5:126786694-126786716 GTTGATTTTCAGATCCCTTTGGG + Intronic
997825090 5:137098998-137099020 CTGGATTTTAACATCCCTTTGGG - Intronic
997864571 5:137449678-137449700 CAGGAGTTCCAGATCAGTCTAGG + Intronic
997967749 5:138373129-138373151 CAGGAGTTTGAGATCACCCTGGG + Intronic
998004034 5:138645544-138645566 CTGGAGTTTGAGATCAGCCTGGG - Intronic
999004629 5:147962173-147962195 CTGGGTTTATAGATCACTCAAGG + Intergenic
999807737 5:155098825-155098847 CTGGGTTTGCAGAACACTCTGGG + Intergenic
1000513563 5:162212759-162212781 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1000538066 5:162504519-162504541 CTGGGTTCTAACATCACTCTTGG + Intergenic
1000675137 5:164112505-164112527 CTGTATTTTCAGTGCACTTTTGG + Intergenic
1002540191 5:179901574-179901596 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1004040652 6:11971727-11971749 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1004201979 6:13556920-13556942 CTGGATTTAGAGATCAGCCTGGG - Intergenic
1004218647 6:13725697-13725719 CTGGTATTTCAGATCACCCACGG - Intergenic
1004237514 6:13887456-13887478 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1004512856 6:16296880-16296902 CTGGAGTTTGAGACCAGTCTGGG - Intergenic
1004514328 6:16309017-16309039 CAGGAGTTTCAGACCAGTCTGGG + Intronic
1004598513 6:17124787-17124809 CAGGAGTTTGAGATCACCCTGGG + Intronic
1004770682 6:18777746-18777768 CAGGAGTTTGAGATCAATCTGGG + Intergenic
1006138594 6:31912983-31913005 CAGGATTTCAAGACCACTCTGGG + Intronic
1006488053 6:34361012-34361034 CAGGAGTTTGACATCACTCTGGG + Intronic
1007791547 6:44311797-44311819 CTGGAGTTAAAGATCACTCTAGG - Intronic
1007972467 6:46066770-46066792 CTGAACCTTCAGATCATTCTAGG - Intronic
1008105459 6:47436221-47436243 CAGGAGTTTGAGATCACCCTGGG + Intergenic
1008119503 6:47595979-47596001 CTGGTTTTTCAGGTCGCTTTGGG - Exonic
1009830668 6:68928315-68928337 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1010144020 6:72645159-72645181 CTGGATTTTAAGATCAATCTGGG + Intronic
1010587216 6:77667663-77667685 CTGCATTTCCACAGCACTCTGGG - Intergenic
1010661992 6:78582231-78582253 CTGTATTTTCAGGTCTCTCCTGG + Intergenic
1011041551 6:83034971-83034993 CTGGAGTTTAAGATCAGCCTGGG + Intronic
1011074503 6:83423898-83423920 CAGGAGTTTCAGACCAGTCTGGG + Intronic
1011103943 6:83758227-83758249 CAGGAGTTTGAGATCACCCTGGG + Intergenic
1011606156 6:89107770-89107792 CTAGATTCTCAGACCTCTCTTGG + Intronic
1013037031 6:106395184-106395206 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1013229210 6:108146344-108146366 CTGGTGTTTGAGATCAGTCTGGG - Intronic
1013519836 6:110923183-110923205 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1013574926 6:111473267-111473289 CAGGATTTTGAGACCAGTCTGGG - Intronic
1014446815 6:121537355-121537377 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1015040044 6:128705225-128705247 CGGGAGTTTCAGATCAACCTGGG + Intergenic
1015286055 6:131487852-131487874 CTTGACTCTCAGCTCACTCTCGG - Intergenic
1015498671 6:133907910-133907932 CTGGAGTTTCAGACCAGCCTGGG - Intergenic
1015531596 6:134226480-134226502 CTGGAGTTTGAGACCAGTCTGGG + Intronic
1015542744 6:134332461-134332483 CTGGAGTTTGAGACCAGTCTGGG - Intergenic
1015869281 6:137759753-137759775 CTGGATCATAAGGTCACTCTTGG + Intergenic
1016344034 6:143092325-143092347 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1016467941 6:144345464-144345486 CTGGAGTTCGAGACCACTCTGGG + Intronic
1016797738 6:148135824-148135846 CTGGAGTTTGAGATCAGCCTAGG + Intergenic
1017122327 6:151036205-151036227 CAGGAGTTTGAGACCACTCTGGG + Intronic
1017271891 6:152516792-152516814 CTGGAGTTTGAGATCAGCCTGGG - Intronic
1018880014 6:167868335-167868357 CAGGAGTTTCAGATCAGCCTGGG + Intronic
1020033833 7:4951806-4951828 CAGGAGTTTCAGACCAGTCTGGG - Intronic
1020442568 7:8234012-8234034 CAGGAGTTTCAGATCAGCCTGGG + Intronic
1020663548 7:11010861-11010883 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1021044819 7:15909460-15909482 CTGGATTTCATGATCACTGTTGG - Intergenic
1021557622 7:21937424-21937446 CAGGAGTTTCAGACCACCCTGGG + Intronic
1021811991 7:24411469-24411491 CTGGCTTTTCAGTTTACTTTAGG - Intergenic
1021846081 7:24764000-24764022 CTGTATTCTTAGATAACTCTTGG - Intergenic
1022657740 7:32335936-32335958 CAGGTGTTTGAGATCACTCTGGG - Intergenic
1022879152 7:34567663-34567685 CTCTATTTTCAACTCACTCTTGG - Intergenic
1023590502 7:41776445-41776467 CAGGAATTTCAGACCAGTCTGGG + Intergenic
1023640200 7:42249884-42249906 CAGGAGTTTGAGATCACCCTGGG + Intergenic
1024200196 7:47098426-47098448 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1024650833 7:51402048-51402070 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1025054953 7:55757628-55757650 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1025118220 7:56276661-56276683 GTGGAGTTTCAGATAACTCCTGG - Intergenic
1025133024 7:56387850-56387872 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1025717521 7:63975956-63975978 CAGGAGTTTGAGATCAGTCTAGG + Intergenic
1025942669 7:66085568-66085590 CAGGAGTTTCAGACCACTCTGGG + Intronic
1026085728 7:67261432-67261454 CAGGAGTTTGAGACCACTCTGGG + Intergenic
1026202284 7:68224660-68224682 CTGGAGTTTCAAATAACTCTTGG - Intergenic
1026290928 7:69005374-69005396 ATGGATTTTGAGATGTCTCTGGG - Intergenic
1026419672 7:70221114-70221136 CAGGAGTTTGAGACCACTCTGGG - Intronic
1026511190 7:71028568-71028590 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1027058857 7:75069412-75069434 CTGGAGTTCCAGACCACGCTGGG - Intronic
1027203942 7:76082084-76082106 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1027562114 7:79743697-79743719 CTGGAGTTTGAGATCAGCCTGGG - Intergenic
1027603211 7:80265898-80265920 CTTGATTTTTAGATCACTGGTGG - Intergenic
1028037880 7:86007929-86007951 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1029347605 7:99989918-99989940 CAGGAGTTCCAGATCAGTCTGGG + Intergenic
1029465516 7:100722236-100722258 CTGGAGTTTCAGACCAACCTAGG + Intronic
1029509175 7:100982635-100982657 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1029520409 7:101057669-101057691 CAGGAGTTTGAGATCACCCTGGG + Intronic
1029682275 7:102119753-102119775 CAGGAGTTTGAGACCACTCTGGG - Intronic
1030558089 7:111051912-111051934 CTACATTTTCAGATTTCTCTGGG - Intronic
1031086679 7:117308973-117308995 CAGGAGTTTCAGACCACCCTGGG + Intronic
1031505244 7:122574235-122574257 CAGGAGTTTGAGACCACTCTTGG + Intronic
1032199822 7:129812001-129812023 CAGGAGTTTCAGACCAGTCTGGG - Intergenic
1032372997 7:131378619-131378641 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1033212524 7:139470581-139470603 CAGGATTTTGAGATCAGCCTGGG + Intronic
1033533133 7:142286363-142286385 CAGGATTTTGAGATCAGCCTGGG - Intergenic
1033971212 7:147041946-147041968 CTATATTTTCAGATCTCTATTGG - Intronic
1034523835 7:151641717-151641739 CTGGAGTTTCAGACCAGCCTGGG - Intronic
1035145967 7:156817119-156817141 CTGAATTTCCAGATCACCATAGG + Intronic
1036074404 8:5478833-5478855 CTGCATTTCCAGAGCACTCAAGG + Intergenic
1036927403 8:12920426-12920448 CTGGATTTTGAGACTACCCTGGG + Intergenic
1037271742 8:17137546-17137568 CTGTATTTTCATTTCACACTGGG + Intergenic
1037292011 8:17360980-17361002 GTGGATTTCCAGGTCTCTCTTGG - Intronic
1037597862 8:20369465-20369487 CTGGCTTTCCAGCTCACTATGGG + Intergenic
1037843487 8:22262329-22262351 CTGGAGTTTGAGATCAGCCTGGG - Intergenic
1037979829 8:23244704-23244726 CTGGATCTACAGATCAATTTGGG + Intronic
1038731629 8:30133123-30133145 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1039318934 8:36406780-36406802 CAGGATTTTCAGAACAGCCTGGG + Intergenic
1039486582 8:37914904-37914926 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1039687670 8:39823155-39823177 CTGGATTTTGTGATCTCTCCAGG - Intronic
1040772588 8:50995784-50995806 CTGGGTTTTAAGATTACTGTAGG + Intergenic
1041723699 8:60998982-60999004 CTGGGTTCTCAAACCACTCTGGG - Intergenic
1041839589 8:62253365-62253387 CAGGAGTTCCAGATCAGTCTGGG + Intronic
1042510611 8:69607570-69607592 CTGGAGTTCCAGATCAGCCTGGG - Intronic
1042637660 8:70895774-70895796 CTGGAGTTTGAGATCAGCCTGGG + Intergenic
1042921648 8:73925848-73925870 CAGGAGTTTCAGATCAGCCTTGG - Intergenic
1043429315 8:80179395-80179417 CAGGAGTTTAAGATCAGTCTGGG - Intronic
1043445110 8:80311833-80311855 CAGGACTTTGAGATCACCCTGGG - Intergenic
1044528412 8:93278623-93278645 GTGGATTTTCAGATGAATTTAGG + Intergenic
1044738035 8:95299161-95299183 CAGGAGTTTCAGACCACTCCAGG - Intergenic
1044749885 8:95406029-95406051 GAGGCTTTTCAAATCACTCTGGG - Intergenic
1045007871 8:97931909-97931931 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1045463109 8:102443665-102443687 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1046136446 8:110033510-110033532 CAGGAGTTTGAGATCACCCTGGG + Intergenic
1046300567 8:112280478-112280500 CAGGAGTTTGAGATCACCCTGGG - Intronic
1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG + Intergenic
1046958850 8:120088603-120088625 CAGGAGTTTGAGATCACCCTAGG - Intronic
1047496855 8:125414799-125414821 CTGGAGTTTGAGACCAGTCTGGG - Intergenic
1047934741 8:129765838-129765860 ATGGCTTTTCAGGTTACTCTGGG + Intronic
1048116228 8:131526345-131526367 CTGAATTTTCCAATCACTCTGGG - Intergenic
1048415258 8:134221072-134221094 CTGAATCTACAGATCACTTTGGG - Intergenic
1049112214 8:140653879-140653901 CTGGCTTTTAAGAACACTCCAGG + Intergenic
1049633557 8:143673088-143673110 CAGGAATTTCAGATCAGCCTGGG + Intergenic
1049635413 8:143685629-143685651 CAGGAGTTTGAGATCAGTCTTGG + Intronic
1050122642 9:2323323-2323345 CAGGATTTTGAGACCAATCTGGG - Intergenic
1050516080 9:6445770-6445792 CAGGAGTTTGAGATCAGTCTAGG - Intronic
1051027284 9:12627915-12627937 CTGGAGTTTCAGACCAGCCTGGG - Intergenic
1051319292 9:15883266-15883288 CAGGAGTTTCAGACCAGTCTGGG - Intronic
1052203175 9:25807089-25807111 CTTGATTTTAACAGCACTCTTGG - Intergenic
1052315765 9:27115288-27115310 CAGGAGTTTCAGATCAGCCTGGG + Intronic
1052977830 9:34424659-34424681 CTGGATTCTCAGGCCACTCCTGG - Intronic
1053865123 9:42429432-42429454 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1054447884 9:65386574-65386596 GTGAATTTTCAGCTGACTCTAGG + Intergenic
1054664511 9:67723257-67723279 GTGAATTTTCAGCTGACTCTAGG - Intergenic
1055232393 9:74081266-74081288 CTGAATCTTTAGATCACTTTGGG + Intergenic
1055703140 9:78968587-78968609 CTGGAGTTTGAGACCAGTCTGGG + Intergenic
1055709991 9:79050201-79050223 CAGGAGTTTAAGATCAGTCTGGG - Intergenic
1055738027 9:79353913-79353935 CAGGAGTTTGAGATCAATCTGGG + Intergenic
1055947088 9:81701395-81701417 CAGGAATTTCAGATCAGCCTGGG - Intergenic
1056437917 9:86590868-86590890 CTTGATTTTGAGATCTTTCTGGG - Intergenic
1056900274 9:90592663-90592685 CTGGAGTTTGAGATAAGTCTGGG - Intergenic
1057717632 9:97507328-97507350 CTGAATTTTTAAATCTCTCTTGG - Intronic
1057730461 9:97603897-97603919 CTGGAGTTTGAGACCAGTCTGGG - Intronic
1058060383 9:100489397-100489419 CAGGAGTTTGAGATCAGTCTGGG - Intronic
1058433371 9:104939352-104939374 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1058600953 9:106669773-106669795 CTGGTTTTTCAGTTCACAGTAGG - Intergenic
1058698371 9:107579495-107579517 TTGAATTTGCAGATCAGTCTAGG + Intergenic
1059013507 9:110488651-110488673 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1059962181 9:119576330-119576352 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1060540296 9:124424745-124424767 CTGGAGTTTGAGATCAGCCTGGG + Intergenic
1061698772 9:132398796-132398818 CTGGAGTTTAAGACCAGTCTGGG - Intronic
1203487673 Un_GL000224v1:72645-72667 CAGGAGTTTGAGATCACCCTGGG - Intergenic
1203500294 Un_KI270741v1:14540-14562 CAGGAGTTTGAGATCACCCTGGG - Intergenic
1185471308 X:385573-385595 CAGGAATTCCAGAGCACTCTAGG + Intronic
1185924976 X:4135783-4135805 CTGGGATTTGAGATCACTTTGGG - Intergenic
1185970203 X:4654225-4654247 CTGGAGTTTCAGATCAGCCTGGG + Intergenic
1185983188 X:4802469-4802491 CTGGATTTTGAGACCAGCCTGGG + Intergenic
1186295972 X:8148803-8148825 CTGAATTTTCAGTTCCTTCTGGG + Intergenic
1186925511 X:14329454-14329476 CTGGAATTTGAGATCCATCTGGG - Intergenic
1188193474 X:27199598-27199620 CAGGAGTTTCAGATCAGCCTGGG + Intergenic
1188209991 X:27411259-27411281 CAGGATTTTGAGATCAGCCTAGG - Intergenic
1188222953 X:27562470-27562492 CTGCTTTCTCAGATCACTCCTGG + Intergenic
1188526239 X:31090898-31090920 CAGGAGTTTCAGACCACCCTGGG + Intergenic
1189120362 X:38387862-38387884 CTGGAATTTGGGATCACACTAGG - Intronic
1189348141 X:40258042-40258064 CAGGAGTTTGAGATCACCCTGGG - Intergenic
1189455275 X:41182161-41182183 CTGGAGTTTGAGATCAGCCTGGG + Intronic
1190187398 X:48247603-48247625 CTGGAGTTTGAGACCAGTCTGGG - Intronic
1190737454 X:53264972-53264994 CAGGAGTTTCAGATCAGCCTGGG - Intronic
1192724344 X:73732156-73732178 CAGGAGTTTGAGATCAGTCTGGG + Intergenic
1192779013 X:74275396-74275418 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1195400229 X:104453680-104453702 CAGGAGTTTGAGATCAGTCTGGG - Intergenic
1195482640 X:105364489-105364511 CTGAATCTTTAGATCACTTTGGG + Intronic
1195632361 X:107070811-107070833 CAGGAGTTTGAGATCAGTCTGGG + Intronic
1195872959 X:109505190-109505212 CTGGATTCTCTGATCATTTTGGG - Intergenic
1196891139 X:120292048-120292070 CAGGAGTTTGAGACCACTCTAGG - Intronic
1196908830 X:120465962-120465984 CTGCATTTTCTGATGGCTCTTGG - Intronic
1196959652 X:120987597-120987619 CTTGATTCTCAGATCAACCTTGG - Intergenic
1197241335 X:124126246-124126268 CAGGAGTTTCAGACCAGTCTGGG - Intronic
1197342668 X:125292045-125292067 CTGAATTCTCAGAGCACTTTTGG - Intergenic
1197741156 X:129895259-129895281 CTGGAGTTTGAGACCACCCTGGG + Intergenic
1198631290 X:138641651-138641673 CTGGATTTTGAAATCACTGGTGG - Intronic
1199782280 X:151073591-151073613 CGGGATTTTGAGATCAGCCTGGG - Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200827313 Y:7658432-7658454 ATGGATTTGCAGATCAGGCTGGG + Intergenic
1200944440 Y:8819460-8819482 CTGCATTTCCAGAGCACTTTGGG - Intergenic
1200954441 Y:8929949-8929971 ATGGATTTGCAGATCAGTCTGGG - Intergenic