ID: 929788965

View in Genome Browser
Species Human (GRCh38)
Location 2:45010162-45010184
Sequence CAGCGGTCCTCGAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929788959_929788965 -2 Left 929788959 2:45010141-45010163 CCATCCTAGAAACTCTGGACTCA 0: 1
1: 0
2: 1
3: 23
4: 220
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
929788958_929788965 -1 Left 929788958 2:45010140-45010162 CCCATCCTAGAAACTCTGGACTC 0: 1
1: 0
2: 2
3: 5
4: 144
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
929788953_929788965 5 Left 929788953 2:45010134-45010156 CCCACCCCCATCCTAGAAACTCT 0: 1
1: 0
2: 3
3: 17
4: 244
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
929788952_929788965 6 Left 929788952 2:45010133-45010155 CCCCACCCCCATCCTAGAAACTC 0: 1
1: 1
2: 2
3: 30
4: 335
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
929788960_929788965 -6 Left 929788960 2:45010145-45010167 CCTAGAAACTCTGGACTCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
929788957_929788965 0 Left 929788957 2:45010139-45010161 CCCCATCCTAGAAACTCTGGACT 0: 1
1: 0
2: 2
3: 19
4: 171
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
929788956_929788965 1 Left 929788956 2:45010138-45010160 CCCCCATCCTAGAAACTCTGGAC 0: 1
1: 0
2: 1
3: 6
4: 150
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72
929788954_929788965 4 Left 929788954 2:45010135-45010157 CCACCCCCATCCTAGAAACTCTG 0: 1
1: 0
2: 0
3: 32
4: 293
Right 929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929788965 Original CRISPR CAGCGGTCCTCGAGGGAAAA GGG Intergenic
903011355 1:20332875-20332897 CAGCCGTTCTCCAGGGAAGAGGG - Exonic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
907803489 1:57794943-57794965 TAGCGGTCCTCATGGGAAGATGG + Intronic
915297255 1:154929982-154930004 CAACGCTCCTGGAGGGAAACTGG - Intronic
916546584 1:165811479-165811501 CAGTGGTCCTGGGAGGAAAAGGG - Intronic
1067710622 10:48648675-48648697 CAGCTGTCCTGGGGGGAAAATGG + Intronic
1067781944 10:49214089-49214111 CAGGGGGCCTAAAGGGAAAATGG - Intergenic
1073251148 10:102120862-102120884 CCGCGCTCCGGGAGGGAAAAGGG + Intergenic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075728356 10:124622192-124622214 CAGCAGTCCTCAAGGACAAACGG + Exonic
1075969511 10:126640532-126640554 CCACGGTCCTGGAGGGAAAAAGG + Intronic
1077485538 11:2836844-2836866 CAGGGGCCCTAGAGGGAAATGGG + Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1092810236 12:12266343-12266365 CTGGGGTCTTCCAGGGAAAAGGG - Intronic
1092907706 12:13116985-13117007 CAGCTGTCCTCTTGGGAAGAGGG - Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112226215 13:97543310-97543332 CAGCGGTCTCCGTGGGAACAGGG - Intergenic
1113059868 13:106311103-106311125 TAGCGATCCTCTAGGGAGAAGGG - Intergenic
1113201322 13:107868802-107868824 CAGCGCTCCTTAAAGGAAAATGG - Intergenic
1122971972 14:105156037-105156059 CAGGGGTCCTCCAGGAACAACGG + Intronic
1132503192 16:293653-293675 CAGGGGTGCTCAAGGGACAAGGG + Exonic
1132888783 16:2194333-2194355 CAGCTGTCCTTGAGGGGAAGAGG - Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1137297670 16:47111907-47111929 CAGCACTCCACCAGGGAAAAGGG + Intronic
1139378453 16:66515409-66515431 CAGCGGAGCCCAAGGGAAAAGGG + Intronic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1141004329 16:80337998-80338020 CAGCTGTCCTCCAGGAAAAGTGG + Intergenic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1151260784 17:72914494-72914516 CACCAGTCCTTGATGGAAAATGG - Intronic
1163329500 19:16627745-16627767 CAGCGGCCCTCGAGGGGAGGTGG + Intronic
1167691430 19:50986376-50986398 CAGGGATCCTCGAGGGTAGAGGG - Intergenic
1167797170 19:51716959-51716981 CAGCGGTCCTCTAGGTAAGCAGG - Exonic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
932136838 2:69238813-69238835 CAGAGGTCATCTAAGGAAAATGG - Intronic
938686427 2:133742417-133742439 CAGAGGCCCTGGAGGAAAAAGGG - Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
943048639 2:182889143-182889165 CAGCGGTCCCTGAGGGCAACGGG - Intergenic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
1175626126 20:60489546-60489568 CAGCGTTCCTGGAGGGAGCACGG + Intergenic
1182297160 22:29316332-29316354 CAGCCGTCCTCGAGGGGAAGTGG + Intronic
1183796257 22:40120931-40120953 CAGGTGTCCCCAAGGGAAAAGGG + Intronic
1184675011 22:46036783-46036805 CAGAGGCCCTGGAGGGCAAAGGG + Intergenic
952011034 3:28901689-28901711 TAGCTGACCTTGAGGGAAAATGG - Intergenic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954755152 3:52835217-52835239 CAGCTGTCCCAGAGGGCAAAGGG - Exonic
963370476 3:144393256-144393278 CAAGGGTCCTCTAGGGGAAAAGG + Intergenic
964559113 3:157973960-157973982 CAGCAATCCTCTAGGGAAAGGGG - Intergenic
964744876 3:160003002-160003024 CAGTGGTCCTCCAGGCAAAGTGG + Intergenic
968357969 3:198122990-198123012 CAGGGGTCCAGGAGGGAACAGGG + Intergenic
968511954 4:999742-999764 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968511975 4:999828-999850 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
968511996 4:999914-999936 CAGGCGTCCTCAAGGGAGAAGGG - Intronic
969574506 4:8029150-8029172 CAGCTGTCCTCACGGGAGAATGG - Intronic
984048692 4:174836440-174836462 CTGCGGGCCTCGAGTTAAAATGG - Intronic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
992549087 5:77844710-77844732 CTGGGGGCCTCGCGGGAAAATGG - Intronic
992982338 5:82188694-82188716 CAGAGGACCTGGAGGGGAAATGG + Intronic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
1003203719 6:3988114-3988136 CAAAGATCCTTGAGGGAAAAAGG + Intergenic
1007389874 6:41545089-41545111 CAGTGGTCCTTGAAAGAAAAGGG - Intergenic
1017750785 6:157488640-157488662 CAGCGACCCTTGAGGGAAAGAGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1033751859 7:144366255-144366277 CAGGGGTCCAGAAGGGAAAATGG - Intronic
1034984096 7:155496833-155496855 CAGAGGTCCTCGTGGGGAGAGGG - Intronic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1041571484 8:59342271-59342293 CAGCCGACCTTGATGGAAAATGG - Intergenic
1043113301 8:76215821-76215843 CAGCTGTACTCCAGGGAAGATGG - Intergenic
1048475121 8:134736022-134736044 CACCTGTCCTGGAGGGAAACTGG + Intergenic
1049261398 8:141641116-141641138 CAGAGGTGCTCCAGGGAAAATGG - Intergenic
1060006026 9:120000647-120000669 CAGAGCTCCTCTAGGGAACAGGG - Intergenic
1187581939 X:20616505-20616527 CAACTGTCCTGGAGGGAAACTGG + Intergenic
1188897152 X:35683136-35683158 AAAGGGTCATCGAGGGAAAAGGG + Intergenic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1197173257 X:123457523-123457545 CAGTGTTCCTCAAAGGAAAATGG - Intronic