ID: 929789218

View in Genome Browser
Species Human (GRCh38)
Location 2:45011321-45011343
Sequence GCTTTCTGCAGAAATCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929789216_929789218 1 Left 929789216 2:45011297-45011319 CCAGTGCGGGTGCAGAAAGGGGA 0: 1
1: 0
2: 0
3: 10
4: 127
Right 929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 207
929789208_929789218 29 Left 929789208 2:45011269-45011291 CCACAGGGCTGACAAAGTAGGTC 0: 1
1: 0
2: 1
3: 8
4: 93
Right 929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 207
929789211_929789218 7 Left 929789211 2:45011291-45011313 CCCAAGCCAGTGCGGGTGCAGAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 207
929789212_929789218 6 Left 929789212 2:45011292-45011314 CCAAGCCAGTGCGGGTGCAGAAA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929789218 Original CRISPR GCTTTCTGCAGAAATCCAGG TGG Intergenic
900196992 1:1381468-1381490 CCATTCTGCAGAAAACCAGATGG - Intergenic
900526861 1:3133620-3133642 GATTTCTACAGAAAGCCACGTGG + Intronic
900774547 1:4572334-4572356 GGTTGCTACAGAAGTCCAGGTGG + Intergenic
902244558 1:15111944-15111966 GCTTCAGGCAGAAAGCCAGGTGG + Intronic
902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG + Intergenic
903377675 1:22876783-22876805 CCTTTCTCCTGGAATCCAGGGGG - Intronic
904359493 1:29962730-29962752 GCTTTCTGGAAAGACCCAGGTGG + Intergenic
905684306 1:39897863-39897885 GCTTCATGCAGGGATCCAGGGGG + Exonic
907419301 1:54336233-54336255 GCTTACTGCAGAGACCCAGTGGG - Intronic
907456533 1:54579948-54579970 GCTTTCTACAGAAATACAGCTGG - Intronic
912629284 1:111233217-111233239 GTTTTCATCAGAAATCCCGGGGG + Intronic
916638378 1:166699180-166699202 TCTTTCTCCAGATATCCAAGGGG + Intergenic
918743709 1:188170798-188170820 GCTTTCTGCAGAGATGAAGAAGG + Intergenic
919363671 1:196628991-196629013 GCTCTCTGCAGATATACAAGGGG - Intergenic
919615503 1:199803514-199803536 GCCTTCTGCAGGCATCCAAGGGG - Intergenic
920879208 1:209864551-209864573 GATTTGTGCAAAAATCCTGGAGG - Intergenic
921172001 1:212558633-212558655 GCTTTCGGGAGAAAGCCAGAGGG - Intergenic
923083701 1:230684958-230684980 GCCTTCTGAAGAAAACCATGTGG - Intronic
923454122 1:234148154-234148176 TCTTCCTGCAGACCTCCAGGTGG + Intronic
923673198 1:236058747-236058769 GCTTTCTGCAATAGTCTAGGGGG + Intronic
1062850842 10:741631-741653 GATTGCTGCAGACTTCCAGGTGG + Intergenic
1063220201 10:3960110-3960132 ACATTCTGCAGAATTCCAGATGG - Intergenic
1063258375 10:4354579-4354601 TCTTTCACCAGAAATACAGGTGG + Intergenic
1065786134 10:29217217-29217239 GGTCTCTGCACAAATGCAGGAGG + Intergenic
1067986950 10:51159833-51159855 GCATTCTGCATAAATCTAGATGG + Intronic
1070665915 10:78343241-78343263 GTTATCTGCAGAATCCCAGGTGG + Intergenic
1071062829 10:81593259-81593281 TCTTTCTGCTTTAATCCAGGAGG - Intergenic
1071563294 10:86659091-86659113 GCTTTCTGCTCAAATCTAGCAGG + Intronic
1074394420 10:113085834-113085856 TGTTTCTGGAGAAAGCCAGGAGG + Intronic
1078100339 11:8326760-8326782 GCTTTCTTCAGCCATCCATGGGG + Intergenic
1080210955 11:29784446-29784468 GCTTCTTGCAGAAAGCCAGCCGG - Intergenic
1080304471 11:30821442-30821464 GCTTTGTGCAGAATTAAAGGAGG + Intergenic
1081288005 11:41296227-41296249 GCTTTCACAAGAAATCCTGGCGG + Intronic
1081396978 11:42597852-42597874 GCTCTCTGCAGCATACCAGGTGG + Intergenic
1081879758 11:46438596-46438618 GCCTTATTCTGAAATCCAGGGGG - Intronic
1082676115 11:56105099-56105121 ACTTTCTGAAGAGATCCAGATGG + Exonic
1083491695 11:63018819-63018841 GCATTCTGGACAATTCCAGGTGG + Intergenic
1084539836 11:69779142-69779164 TCTTTCTGCAAAAGTCCAGGAGG + Intergenic
1084790398 11:71472109-71472131 GCCTCATGGAGAAATCCAGGTGG - Intronic
1085776563 11:79371818-79371840 TCTTTCTTCAGAATTACAGGGGG - Intronic
1088631197 11:111775367-111775389 CATTTCGGCAGAAATCCAGCTGG + Intergenic
1091566303 12:1651000-1651022 GCTTTCAGCAGAATATCAGGAGG + Intergenic
1092117280 12:6018542-6018564 GCTGCCTGGAGACATCCAGGTGG - Exonic
1092160247 12:6311828-6311850 GCTTTCTGGATACACCCAGGTGG - Intronic
1092889373 12:12954472-12954494 GCTGTCAGCAGAACTGCAGGAGG + Intergenic
1094270485 12:28609042-28609064 CCTTTCTGCATAGCTCCAGGAGG + Intergenic
1095137622 12:38624979-38625001 TCTATATGCAGAAATCCAGTAGG - Intergenic
1095279027 12:40327716-40327738 GCTTTCTGCTGAGTCCCAGGAGG - Intronic
1095306580 12:40645653-40645675 GCTGTCTGCAGAGATACAAGGGG + Intergenic
1097973242 12:65657656-65657678 GCTTTATCCTGAGATCCAGGAGG + Intergenic
1098212566 12:68181950-68181972 GCTTGGTGCTGAAATCCAGATGG - Intergenic
1101566220 12:105908221-105908243 GAATTCTGCAGAAGTCCAGATGG - Intergenic
1103055410 12:117816271-117816293 GCCGTCTGCAGAACTCCAGGTGG - Intronic
1103433368 12:120905990-120906012 GCCTTCTGCAGAGAAACAGGGGG - Intergenic
1105565341 13:21540469-21540491 GCAGTCTGTAGAAATTCAGGTGG + Intronic
1106067391 13:26368239-26368261 AGTTTCTGCAGTAATCCAAGTGG - Intronic
1108672781 13:52708691-52708713 AATTTTTGCAGAAATCCAGAGGG - Exonic
1112627550 13:101122917-101122939 TCTTTTTGGAGAAATCCAGGTGG + Intronic
1112853357 13:103734292-103734314 ACTCTCTGCAGAGTTCCAGGTGG + Intergenic
1112880859 13:104104819-104104841 GCTTTCTGCATAAATGAAGAGGG - Intergenic
1113630515 13:111879918-111879940 GCTTGCTGCAGAAACCCTGCCGG + Intergenic
1114502742 14:23183210-23183232 CCTTTCAGCAGAATTCCAGCCGG - Exonic
1115211815 14:30974526-30974548 GTTTTCTGCAGAAATAAAGTTGG - Intronic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1122310779 14:100792730-100792752 GTTTTCTGGAGAAAGTCAGGGGG + Intergenic
1122396437 14:101436005-101436027 GAGTTTTGCAGAAATCCAGGTGG - Intergenic
1126199438 15:45969228-45969250 GCTCCCTCCAGAACTCCAGGTGG + Intergenic
1126740030 15:51768274-51768296 TCTTTCTGTCGAAATCCAGCTGG - Exonic
1128231104 15:66036043-66036065 GCTTTCTCCCGAGTTCCAGGAGG + Intronic
1128764533 15:70243130-70243152 GCTTTCTGGAGAAGCACAGGTGG - Intergenic
1129508289 15:76101462-76101484 CCTGTCTGAAGAGATCCAGGAGG + Intronic
1132720047 16:1311331-1311353 GCTTTCTCCAGAAGGCCAGTAGG + Intronic
1133033654 16:3023189-3023211 GCCTTCTGCAGAATCACAGGCGG - Intronic
1134609757 16:15598684-15598706 CCATTCTGCAGGAACCCAGGTGG + Intronic
1135318428 16:21471947-21471969 AATTTCTGCAGAAATTAAGGAGG - Intergenic
1135371321 16:21903742-21903764 AATTTCTGCAGAAATTAAGGAGG - Intergenic
1135440466 16:22466973-22466995 AATTTCTGCAGAAATTAAGGAGG + Intergenic
1137895380 16:52206152-52206174 AGTTTCTGCATAAATCCAGTAGG - Intergenic
1138690399 16:58762506-58762528 GCTTTCTGCAGAAATTGACAAGG - Intergenic
1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG + Intronic
1142943393 17:3402791-3402813 GCTTTGTAAAGATATCCAGGTGG + Intergenic
1143172606 17:4938856-4938878 GCCTTCAGCAGAAAGCCAGGGGG + Exonic
1144199183 17:12923947-12923969 GCTTTATGGAGAAATGCAGGGGG - Intronic
1145165621 17:20611559-20611581 CCTTTCTGCAGAGAGCCAGTTGG - Intergenic
1146258597 17:31406179-31406201 GCTCACTGCAGAAAGCCTGGAGG + Intronic
1146512818 17:33465061-33465083 TCTTTATGCAGAGCTCCAGGAGG + Intronic
1147457246 17:40545588-40545610 GATTGCTGCAGGAATCCAGGAGG + Intergenic
1151288359 17:73129987-73130009 GGCTTCTGCAGAAACCCAGTCGG - Intergenic
1154076795 18:11211217-11211239 TCTTGCTGCAGAACCCCAGGGGG + Intergenic
1156793238 18:41004543-41004565 GCTGGCTGCAGAATTCCTGGAGG + Intergenic
1158555774 18:58473521-58473543 GCGTGCTGCACAACTCCAGGGGG + Intergenic
1160432653 18:78822590-78822612 GCCCTCTGCAGAAATCCTAGTGG + Intergenic
1161135851 19:2619395-2619417 CTTTTCTGCAGAGATCCAGATGG - Intronic
1161790948 19:6359796-6359818 ACTTTCTGCACAAACCTAGGAGG + Intergenic
1162058740 19:8081607-8081629 TCTTTCTGCAAAAAGCCAGGTGG + Intronic
1165592448 19:36981344-36981366 AATTTCTGTAGAAATCCAGTTGG + Intronic
1167732854 19:51271479-51271501 GCTTGATGCAAAAATTCAGGAGG + Intergenic
1168359406 19:55726050-55726072 GGTGTCTCCAGAAATCAAGGGGG - Intronic
925816251 2:7753757-7753779 ACTTTCTGCAGGAAACAAGGAGG + Intergenic
925938926 2:8796460-8796482 GCTTGCTGCAGATAAACAGGAGG - Intronic
927097820 2:19761330-19761352 GCTGACTGGTGAAATCCAGGAGG - Intergenic
929737555 2:44566351-44566373 GAATTCTGCAGAAATCCACATGG + Intronic
929782604 2:44966716-44966738 GGGCTCTGCAGAAATCTAGGGGG + Intergenic
929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG + Intergenic
931191306 2:60002966-60002988 TCCTTCTGCAAAAAGCCAGGTGG - Intergenic
932702985 2:74003521-74003543 CCAATCTGCAGAAATCCCGGGGG + Intronic
933049149 2:77580425-77580447 GCCTTCAGCAGAAATCCAGAAGG + Intronic
935578582 2:104736124-104736146 GATGTCTGCAGGGATCCAGGTGG - Intergenic
936011681 2:108929142-108929164 GCTTTCTGCAGAAAACCCCGAGG - Intronic
936157005 2:110053810-110053832 GCTCTGTGCAGAAATCAAGCTGG - Intergenic
936187689 2:110317634-110317656 GCTCTGTGCAGAAATCAAGCTGG + Intergenic
937077357 2:119116970-119116992 GGTCACTGCAGAAATCCAGCAGG + Intergenic
939386124 2:141500688-141500710 GCTTTCTTTTGAAATCCAAGAGG - Intronic
939674011 2:145049534-145049556 GCTTTATACAGAAACCAAGGAGG - Intergenic
939994502 2:148907448-148907470 GCTTTGTGCATTAACCCAGGAGG + Intronic
940590143 2:155713330-155713352 GATTTCTGCAAAAATCCTTGAGG + Intergenic
940741224 2:157510376-157510398 GCATTCAGTTGAAATCCAGGAGG + Intergenic
941921372 2:170854292-170854314 GATTTCTGCAGCAATCCTTGGGG + Intronic
942563126 2:177241442-177241464 TATTTCTGAAGAAAACCAGGTGG + Intronic
942851491 2:180493239-180493261 GCTTTCTGCATATGTCCAGCCGG + Intergenic
945477236 2:210298552-210298574 GCTTTTTGCAGAATTCAAGGAGG - Exonic
947340194 2:229130243-229130265 GGTGTCTGCAGCATTCCAGGTGG - Intronic
947811020 2:233004054-233004076 GCTTGCTGCAGAAATGAAGTCGG - Intronic
948425616 2:237885261-237885283 GAGCTCAGCAGAAATCCAGGAGG - Intronic
948717053 2:239871858-239871880 GCTTTCAGCAGAGAACCATGGGG + Intergenic
949080864 2:242098357-242098379 GGTTTCAGCAAAAATCCAGATGG + Intergenic
1169888457 20:10428439-10428461 GTTATCTGCAGAAATGAAGGTGG - Intronic
1172211806 20:33204799-33204821 GCTTTCTGGAGGAAACCAGTTGG + Intergenic
1175141378 20:56862707-56862729 GGTTTCTGCTGGGATCCAGGGGG - Intergenic
1176072534 20:63234625-63234647 GATTTCTGCAGGAAACCAGGTGG + Intergenic
1176121873 20:63457729-63457751 GGTTGCTGCAGCAATGCAGGGGG - Intronic
1177685436 21:24431139-24431161 GCTTTCTGCAGAAATAGCAGTGG - Intergenic
1182004788 22:26950873-26950895 GCTTACTACAGAGATCTAGGGGG + Intergenic
1182356105 22:29722856-29722878 GCCTGCCGCAGAAATCCAGGGGG + Intronic
1182452990 22:30432360-30432382 TCTTCCTGCAGACCTCCAGGTGG - Intergenic
1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG + Intergenic
1183739127 22:39660475-39660497 GCCTTCTCCACAGATCCAGGTGG + Intronic
1184788150 22:46681871-46681893 TCGTCCTGCAGAACTCCAGGAGG + Intergenic
950822940 3:15781286-15781308 TATTTCTGTAGAAATCCATGAGG + Intronic
952147659 3:30550682-30550704 GCTTTCTGGAAAAAGCCAGTTGG - Intergenic
953955584 3:47229307-47229329 GCTTTCTGCAGTTACCCATGGGG - Intronic
954656883 3:52199284-52199306 GCTTTCTGCAGAAAGGCCTGGGG - Exonic
955023795 3:55147434-55147456 ATTTTATGCAGAATTCCAGGGGG + Intergenic
955553463 3:60109753-60109775 GATTTATGCAGAAAGCCAGCAGG - Intronic
956565939 3:70638861-70638883 CATTTCTGCAGATATTCAGGTGG + Intergenic
956616794 3:71180640-71180662 GGATTTTGCTGAAATCCAGGTGG - Intronic
956841815 3:73147083-73147105 GTTCTCTGCAGAAACCCAAGTGG + Intergenic
957568808 3:81919555-81919577 TCTTTCTGCAGATTTCCACGGGG + Intergenic
958043234 3:88250861-88250883 ACTTTCTGCATAAATCAAAGAGG + Intergenic
958901986 3:99897845-99897867 GCTTTCTGCTGAAATATATGTGG + Intronic
959800384 3:110487188-110487210 GCATTCTGGAGAAATGTAGGGGG + Intergenic
960025837 3:113008277-113008299 ACTTTCTGAAGAAATCCAGATGG - Exonic
961338789 3:126203506-126203528 GCCTTCTGCAGACACCCTGGTGG - Intergenic
962330695 3:134475424-134475446 GCTAACTGCATAAAGCCAGGAGG - Intergenic
964186500 3:153951555-153951577 GCTGCCTGCAGAAATTCTGGTGG + Intergenic
965402576 3:168230426-168230448 GCTTTATACAGAAATTCAGGTGG - Intergenic
965483952 3:169255750-169255772 ACTTTCTGAAGACATCCAGCTGG + Intronic
969827775 4:9771728-9771750 GCGTGCTGCAGAAATACAGAGGG + Intronic
970537759 4:17046726-17046748 GCTTACTTCAGAAATACTGGAGG + Intergenic
971301411 4:25445231-25445253 GCTTTTAGTGGAAATCCAGGAGG + Intergenic
973202476 4:47520188-47520210 TCTATCTGAAGAAAGCCAGGAGG - Intronic
973243971 4:47990236-47990258 TCTTTCTGCAGAAAGCGAGTAGG + Intronic
974210054 4:58760781-58760803 GCTCTCAGTAGAAATCCAGTAGG + Intergenic
975731011 4:77337242-77337264 GATTTCTGAAGAAATCCACCAGG - Intronic
977247607 4:94651737-94651759 TCTTGCTGCAGAAATCAGGGAGG + Intronic
980577935 4:134709363-134709385 GATTTATGCAGAAATGGAGGTGG + Intergenic
982093793 4:151902364-151902386 GTTTTCAGCAGAAATCCTGTGGG - Intergenic
983293892 4:165840936-165840958 TCTTTCAGCAGAAATACAGAAGG + Intergenic
983501777 4:168507586-168507608 GGCTTGTGCAGTAATCCAGGGGG - Intronic
985646301 5:1086206-1086228 GCTCTCTTCAGGAACCCAGGAGG + Intronic
986548707 5:8928558-8928580 GGCTTCTGCAGAATTCGAGGTGG - Intergenic
986590591 5:9365343-9365365 GATTAATGCAAAAATCCAGGAGG + Intronic
987681134 5:21137579-21137601 GCTTTATAAAGAAATCCAGGTGG + Intergenic
988057366 5:26115776-26115798 GCCTTTTGCAGCAATCCTGGGGG + Intergenic
990942066 5:61212898-61212920 GCCTTCAGCAGAAATCATGGTGG + Intergenic
991975129 5:72177643-72177665 CCTTTCTGCAGAAACCCACATGG - Intronic
997215222 5:132104336-132104358 CCTGTGTGCAGAAAACCAGGTGG + Intergenic
997340899 5:133143782-133143804 GTTCTTTCCAGAAATCCAGGTGG + Intergenic
998747819 5:145281365-145281387 GGTTTCTGCAGAAGTACAGTGGG + Intergenic
1000456996 5:161461846-161461868 GATTTGTGCAGAAATCCACTAGG - Intronic
1001487748 5:172131721-172131743 GCTTTTTGCAGAAATACATGGGG + Intronic
1002274310 5:178094539-178094561 GGTTCCTGCAGGAAGCCAGGTGG + Intergenic
1003285170 6:4727960-4727982 GCTTGCTGCAATAATCCTGGAGG - Intronic
1003741876 6:8949848-8949870 GCTTTCTGCAGCCGTCCAGCGGG - Intergenic
1006603596 6:35241736-35241758 GCTGGCTGGAGGAATCCAGGGGG - Intronic
1007019266 6:38503245-38503267 GCCTTCTGCAGAAATGAAAGAGG + Intronic
1007725541 6:43913622-43913644 GCTTTCTGAAGAATTCCTGCAGG + Intergenic
1008200613 6:48584053-48584075 GCTTTCTGTTGACATCCATGTGG - Intergenic
1010084461 6:71900522-71900544 GGCTACTGTAGAAATCCAGGTGG + Intronic
1012858739 6:104533638-104533660 GCTTTCTGTAGAACACCAGGAGG - Intergenic
1013362233 6:109404697-109404719 GCTGTCTGCAGGAATTCAGAAGG + Intronic
1014809639 6:125870905-125870927 TCTTTCTGCATAAATCCTGGAGG - Intronic
1019713561 7:2528416-2528438 GCTCTTTGCAGCAATCCTGGGGG + Exonic
1027189298 7:75988417-75988439 GCTTCCTGCTCAACTCCAGGTGG - Exonic
1029439406 7:100578742-100578764 GGTTACAGGAGAAATCCAGGCGG + Exonic
1032632438 7:133668817-133668839 CCTTTCTGGAGAGAGCCAGGTGG + Intronic
1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG + Intronic
1034022463 7:147659980-147660002 GCATTCTGAGGACATCCAGGTGG - Intronic
1035261410 7:157663718-157663740 GCTTTCTCCAGCAAGCCATGAGG - Intronic
1036727274 8:11231251-11231273 GGTCTCTGCAGGAATCCAGGTGG + Intergenic
1037185464 8:16057420-16057442 CCTTTCTGAAGAAAGCTAGGTGG - Intergenic
1038537822 8:28366886-28366908 GCTTTCTATTGAAAGCCAGGAGG - Intronic
1038844235 8:31213956-31213978 GCTCTCTGTAGACAACCAGGTGG + Intergenic
1038959825 8:32506690-32506712 GCTCTCTGCAGAAATCTTGGGGG + Intronic
1040307575 8:46220166-46220188 GCGGGCTGCAGAAATTCAGGGGG + Intergenic
1040791959 8:51241291-51241313 GGTTTGTACAGAAAGCCAGGGGG + Intergenic
1041795122 8:61738845-61738867 GGTTTCTGCAGATGTCCAGGTGG - Intergenic
1044239429 8:89871115-89871137 GCTTTCAGCAGAACTGGAGGAGG + Intergenic
1044725523 8:95191502-95191524 GCTTTGTGCAGATGTCCTGGGGG + Intergenic
1047421166 8:124709547-124709569 CCTCTCTGAAGAAATTCAGGGGG - Intronic
1047713530 8:127575065-127575087 GCTTTCTGCAGAATGGCTGGGGG - Intergenic
1049478644 8:142809537-142809559 GCTTCCTGGAGAAGGCCAGGTGG + Intergenic
1050996546 9:12226991-12227013 TATTTCTGCAGAAAATCAGGGGG + Intergenic
1052564180 9:30125963-30125985 ACTGTCTGCAGAAAGCCAGTAGG - Intergenic
1054817252 9:69487001-69487023 TCTTTCTGCAGATCTCCAAGGGG - Intronic
1055013876 9:71595351-71595373 CATTTCTAAAGAAATCCAGGAGG + Intergenic
1056096301 9:83257756-83257778 GCTTTCTGAATATATTCAGGAGG - Intronic
1056287955 9:85110323-85110345 TCTTTCTGCAGACATCCATATGG + Intergenic
1057059533 9:91991219-91991241 GCATTGAGCAAAAATCCAGGAGG + Intergenic
1057164514 9:92915125-92915147 GGATTCTGCAGAAGTCCTGGGGG + Intergenic
1057376922 9:94533415-94533437 GCTGTCTGCAGTAACTCAGGTGG + Intergenic
1060206530 9:121685752-121685774 GCTACCTGCAGAAATACAGAAGG + Intronic
1061327553 9:129873572-129873594 GCTCTCTGCAGGAACCCAAGGGG - Intronic
1062255669 9:135619591-135619613 GCTCTCTGCAGAAGCCCAGCGGG + Intergenic
1186554939 X:10547941-10547963 GCTTTCTGCAGTAATCCTCCTGG - Intronic
1187245666 X:17551009-17551031 TCTTTCTCCAGATATCCACGTGG + Intronic
1187421268 X:19135963-19135985 TCTTTTTGTAGAGATCCAGGGGG - Intergenic
1188287776 X:28349222-28349244 TCTTTCTGCAGAGATCCACTTGG + Intergenic
1195881657 X:109599198-109599220 GCATTCAGTAGAAATTCAGGGGG - Intergenic
1196190981 X:112794193-112794215 CCTTTCTGAAGAAATCCACGTGG - Intronic
1198228783 X:134670261-134670283 CCTTACAGCAGAAATCCAGCAGG + Intronic
1198672214 X:139093201-139093223 GCTTTCTGCAACACACCAGGTGG + Intronic