ID: 929789465

View in Genome Browser
Species Human (GRCh38)
Location 2:45012746-45012768
Sequence TTCCATCAGCCTGAGATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929789465_929789470 14 Left 929789465 2:45012746-45012768 CCAGTGATCTCAGGCTGATGGAA No data
Right 929789470 2:45012783-45012805 ACGAATTGTCAGGGACAGTTTGG No data
929789465_929789467 5 Left 929789465 2:45012746-45012768 CCAGTGATCTCAGGCTGATGGAA No data
Right 929789467 2:45012774-45012796 TTGTCCCAGACGAATTGTCAGGG No data
929789465_929789472 16 Left 929789465 2:45012746-45012768 CCAGTGATCTCAGGCTGATGGAA No data
Right 929789472 2:45012785-45012807 GAATTGTCAGGGACAGTTTGGGG No data
929789465_929789466 4 Left 929789465 2:45012746-45012768 CCAGTGATCTCAGGCTGATGGAA No data
Right 929789466 2:45012773-45012795 TTTGTCCCAGACGAATTGTCAGG No data
929789465_929789473 29 Left 929789465 2:45012746-45012768 CCAGTGATCTCAGGCTGATGGAA No data
Right 929789473 2:45012798-45012820 CAGTTTGGGGTCTTTGTGCCTGG No data
929789465_929789471 15 Left 929789465 2:45012746-45012768 CCAGTGATCTCAGGCTGATGGAA No data
Right 929789471 2:45012784-45012806 CGAATTGTCAGGGACAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929789465 Original CRISPR TTCCATCAGCCTGAGATCAC TGG (reversed) Intergenic
No off target data available for this crispr