ID: 929797999

View in Genome Browser
Species Human (GRCh38)
Location 2:45075011-45075033
Sequence GGAGGCAAACAACTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929797984_929797999 24 Left 929797984 2:45074964-45074986 CCTCCTGTTGCATGATTTGTAAC No data
Right 929797999 2:45075011-45075033 GGAGGCAAACAACTTCAGCTGGG No data
929797993_929797999 2 Left 929797993 2:45074986-45075008 CCATGGTGGTGGGAGGGGTCTCT No data
Right 929797999 2:45075011-45075033 GGAGGCAAACAACTTCAGCTGGG No data
929797985_929797999 21 Left 929797985 2:45074967-45074989 CCTGTTGCATGATTTGTAACCAT No data
Right 929797999 2:45075011-45075033 GGAGGCAAACAACTTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929797999 Original CRISPR GGAGGCAAACAACTTCAGCT GGG Intergenic
No off target data available for this crispr