ID: 929799081

View in Genome Browser
Species Human (GRCh38)
Location 2:45084005-45084027
Sequence GAGGGTGGCATGGGTGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799081_929799094 13 Left 929799081 2:45084005-45084027 CCAACAGCACCCATGCCACCCTC No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799081_929799096 21 Left 929799081 2:45084005-45084027 CCAACAGCACCCATGCCACCCTC No data
Right 929799096 2:45084049-45084071 TGGACACATAGGAGGGTCTCAGG No data
929799081_929799091 10 Left 929799081 2:45084005-45084027 CCAACAGCACCCATGCCACCCTC No data
Right 929799091 2:45084038-45084060 TCCCTGCAGCATGGACACATAGG No data
929799081_929799088 1 Left 929799081 2:45084005-45084027 CCAACAGCACCCATGCCACCCTC No data
Right 929799088 2:45084029-45084051 TCTCCCTTCTCCCTGCAGCATGG No data
929799081_929799095 14 Left 929799081 2:45084005-45084027 CCAACAGCACCCATGCCACCCTC No data
Right 929799095 2:45084042-45084064 TGCAGCATGGACACATAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799081 Original CRISPR GAGGGTGGCATGGGTGCTGT TGG (reversed) Intergenic
No off target data available for this crispr