ID: 929799083

View in Genome Browser
Species Human (GRCh38)
Location 2:45084015-45084037
Sequence GAAGGGAGAGGAGGGTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799083_929799094 3 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799083_929799096 11 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799096 2:45084049-45084071 TGGACACATAGGAGGGTCTCAGG No data
929799083_929799091 0 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799091 2:45084038-45084060 TCCCTGCAGCATGGACACATAGG No data
929799083_929799098 28 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799083_929799088 -9 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799088 2:45084029-45084051 TCTCCCTTCTCCCTGCAGCATGG No data
929799083_929799095 4 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799095 2:45084042-45084064 TGCAGCATGGACACATAGGAGGG No data
929799083_929799097 27 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799083 Original CRISPR GAAGGGAGAGGAGGGTGGCA TGG (reversed) Intergenic
No off target data available for this crispr