ID: 929799084

View in Genome Browser
Species Human (GRCh38)
Location 2:45084020-45084042
Sequence AGGGAGAAGGGAGAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799084_929799096 6 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799096 2:45084049-45084071 TGGACACATAGGAGGGTCTCAGG No data
929799084_929799091 -5 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799091 2:45084038-45084060 TCCCTGCAGCATGGACACATAGG No data
929799084_929799094 -2 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799084_929799098 23 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799084_929799097 22 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799084_929799095 -1 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799095 2:45084042-45084064 TGCAGCATGGACACATAGGAGGG No data
929799084_929799099 26 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799084 Original CRISPR AGGGAGAAGGGAGAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr