ID: 929799087

View in Genome Browser
Species Human (GRCh38)
Location 2:45084027-45084049
Sequence ATGCTGCAGGGAGAAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799087_929799097 15 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799087_929799095 -8 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799095 2:45084042-45084064 TGCAGCATGGACACATAGGAGGG No data
929799087_929799099 19 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799087_929799094 -9 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799087_929799096 -1 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799096 2:45084049-45084071 TGGACACATAGGAGGGTCTCAGG No data
929799087_929799098 16 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799087 Original CRISPR ATGCTGCAGGGAGAAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr