ID: 929799088

View in Genome Browser
Species Human (GRCh38)
Location 2:45084029-45084051
Sequence TCTCCCTTCTCCCTGCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799083_929799088 -9 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799088 2:45084029-45084051 TCTCCCTTCTCCCTGCAGCATGG No data
929799081_929799088 1 Left 929799081 2:45084005-45084027 CCAACAGCACCCATGCCACCCTC No data
Right 929799088 2:45084029-45084051 TCTCCCTTCTCCCTGCAGCATGG No data
929799082_929799088 -8 Left 929799082 2:45084014-45084036 CCCATGCCACCCTCCTCTCCCTT No data
Right 929799088 2:45084029-45084051 TCTCCCTTCTCCCTGCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799088 Original CRISPR TCTCCCTTCTCCCTGCAGCA TGG Intergenic
No off target data available for this crispr