ID: 929799094

View in Genome Browser
Species Human (GRCh38)
Location 2:45084041-45084063
Sequence CTGCAGCATGGACACATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799082_929799094 4 Left 929799082 2:45084014-45084036 CCCATGCCACCCTCCTCTCCCTT No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799084_929799094 -2 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799085_929799094 -5 Left 929799085 2:45084023-45084045 CCCTCCTCTCCCTTCTCCCTGCA No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799086_929799094 -6 Left 929799086 2:45084024-45084046 CCTCCTCTCCCTTCTCCCTGCAG No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799081_929799094 13 Left 929799081 2:45084005-45084027 CCAACAGCACCCATGCCACCCTC No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799083_929799094 3 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data
929799087_929799094 -9 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799094 2:45084041-45084063 CTGCAGCATGGACACATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799094 Original CRISPR CTGCAGCATGGACACATAGG AGG Intergenic
No off target data available for this crispr