ID: 929799097

View in Genome Browser
Species Human (GRCh38)
Location 2:45084065-45084087
Sequence TCTCAGGAAATACCTGCGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799085_929799097 19 Left 929799085 2:45084023-45084045 CCCTCCTCTCCCTTCTCCCTGCA No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799083_929799097 27 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799084_929799097 22 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799093_929799097 2 Left 929799093 2:45084040-45084062 CCTGCAGCATGGACACATAGGAG No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799092_929799097 3 Left 929799092 2:45084039-45084061 CCCTGCAGCATGGACACATAGGA No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799086_929799097 18 Left 929799086 2:45084024-45084046 CCTCCTCTCCCTTCTCCCTGCAG No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799082_929799097 28 Left 929799082 2:45084014-45084036 CCCATGCCACCCTCCTCTCCCTT No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799087_929799097 15 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799089_929799097 10 Left 929799089 2:45084032-45084054 CCCTTCTCCCTGCAGCATGGACA No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data
929799090_929799097 9 Left 929799090 2:45084033-45084055 CCTTCTCCCTGCAGCATGGACAC No data
Right 929799097 2:45084065-45084087 TCTCAGGAAATACCTGCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799097 Original CRISPR TCTCAGGAAATACCTGCGTT TGG Intergenic
No off target data available for this crispr