ID: 929799098

View in Genome Browser
Species Human (GRCh38)
Location 2:45084066-45084088
Sequence CTCAGGAAATACCTGCGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799092_929799098 4 Left 929799092 2:45084039-45084061 CCCTGCAGCATGGACACATAGGA No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799084_929799098 23 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799082_929799098 29 Left 929799082 2:45084014-45084036 CCCATGCCACCCTCCTCTCCCTT No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799090_929799098 10 Left 929799090 2:45084033-45084055 CCTTCTCCCTGCAGCATGGACAC No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799093_929799098 3 Left 929799093 2:45084040-45084062 CCTGCAGCATGGACACATAGGAG No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799083_929799098 28 Left 929799083 2:45084015-45084037 CCATGCCACCCTCCTCTCCCTTC No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799086_929799098 19 Left 929799086 2:45084024-45084046 CCTCCTCTCCCTTCTCCCTGCAG No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799087_929799098 16 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799085_929799098 20 Left 929799085 2:45084023-45084045 CCCTCCTCTCCCTTCTCCCTGCA No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data
929799089_929799098 11 Left 929799089 2:45084032-45084054 CCCTTCTCCCTGCAGCATGGACA No data
Right 929799098 2:45084066-45084088 CTCAGGAAATACCTGCGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799098 Original CRISPR CTCAGGAAATACCTGCGTTT GGG Intergenic
No off target data available for this crispr