ID: 929799099

View in Genome Browser
Species Human (GRCh38)
Location 2:45084069-45084091
Sequence AGGAAATACCTGCGTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929799090_929799099 13 Left 929799090 2:45084033-45084055 CCTTCTCCCTGCAGCATGGACAC No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799092_929799099 7 Left 929799092 2:45084039-45084061 CCCTGCAGCATGGACACATAGGA No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799087_929799099 19 Left 929799087 2:45084027-45084049 CCTCTCCCTTCTCCCTGCAGCAT No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799084_929799099 26 Left 929799084 2:45084020-45084042 CCACCCTCCTCTCCCTTCTCCCT No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799089_929799099 14 Left 929799089 2:45084032-45084054 CCCTTCTCCCTGCAGCATGGACA No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799093_929799099 6 Left 929799093 2:45084040-45084062 CCTGCAGCATGGACACATAGGAG No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799085_929799099 23 Left 929799085 2:45084023-45084045 CCCTCCTCTCCCTTCTCCCTGCA No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data
929799086_929799099 22 Left 929799086 2:45084024-45084046 CCTCCTCTCCCTTCTCCCTGCAG No data
Right 929799099 2:45084069-45084091 AGGAAATACCTGCGTTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929799099 Original CRISPR AGGAAATACCTGCGTTTGGG TGG Intergenic
No off target data available for this crispr