ID: 929803551

View in Genome Browser
Species Human (GRCh38)
Location 2:45124884-45124906
Sequence GTTTGGCACACTGCTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929803551_929803559 27 Left 929803551 2:45124884-45124906 CCAAGGGCAGCAGTGTGCCAAAC No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data
929803551_929803558 5 Left 929803551 2:45124884-45124906 CCAAGGGCAGCAGTGTGCCAAAC No data
Right 929803558 2:45124912-45124934 ACAAGACTATCAAACTGGGAAGG No data
929803551_929803557 1 Left 929803551 2:45124884-45124906 CCAAGGGCAGCAGTGTGCCAAAC No data
Right 929803557 2:45124908-45124930 CTGGACAAGACTATCAAACTGGG No data
929803551_929803556 0 Left 929803551 2:45124884-45124906 CCAAGGGCAGCAGTGTGCCAAAC No data
Right 929803556 2:45124907-45124929 CCTGGACAAGACTATCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929803551 Original CRISPR GTTTGGCACACTGCTGCCCT TGG (reversed) Intergenic
No off target data available for this crispr