ID: 929803553

View in Genome Browser
Species Human (GRCh38)
Location 2:45124901-45124923
Sequence TGATAGTCTTGTCCAGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929803553_929803559 10 Left 929803553 2:45124901-45124923 CCAAACCCTGGACAAGACTATCA No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data
929803553_929803560 17 Left 929803553 2:45124901-45124923 CCAAACCCTGGACAAGACTATCA No data
Right 929803560 2:45124941-45124963 CATCTCATTTTATAGGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929803553 Original CRISPR TGATAGTCTTGTCCAGGGTT TGG (reversed) Intergenic
No off target data available for this crispr