ID: 929803554

View in Genome Browser
Species Human (GRCh38)
Location 2:45124906-45124928
Sequence CAGTTTGATAGTCTTGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929803554_929803559 5 Left 929803554 2:45124906-45124928 CCCTGGACAAGACTATCAAACTG No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data
929803554_929803560 12 Left 929803554 2:45124906-45124928 CCCTGGACAAGACTATCAAACTG No data
Right 929803560 2:45124941-45124963 CATCTCATTTTATAGGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929803554 Original CRISPR CAGTTTGATAGTCTTGTCCA GGG (reversed) Intergenic
No off target data available for this crispr