ID: 929803555

View in Genome Browser
Species Human (GRCh38)
Location 2:45124907-45124929
Sequence CCAGTTTGATAGTCTTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929803555_929803560 11 Left 929803555 2:45124907-45124929 CCTGGACAAGACTATCAAACTGG No data
Right 929803560 2:45124941-45124963 CATCTCATTTTATAGGAAACCGG No data
929803555_929803559 4 Left 929803555 2:45124907-45124929 CCTGGACAAGACTATCAAACTGG No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929803555 Original CRISPR CCAGTTTGATAGTCTTGTCC AGG (reversed) Intergenic
No off target data available for this crispr