ID: 929803559

View in Genome Browser
Species Human (GRCh38)
Location 2:45124934-45124956
Sequence GATCTAGCATCTCATTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929803551_929803559 27 Left 929803551 2:45124884-45124906 CCAAGGGCAGCAGTGTGCCAAAC No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data
929803555_929803559 4 Left 929803555 2:45124907-45124929 CCTGGACAAGACTATCAAACTGG No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data
929803554_929803559 5 Left 929803554 2:45124906-45124928 CCCTGGACAAGACTATCAAACTG No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data
929803553_929803559 10 Left 929803553 2:45124901-45124923 CCAAACCCTGGACAAGACTATCA No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data
929803550_929803559 28 Left 929803550 2:45124883-45124905 CCCAAGGGCAGCAGTGTGCCAAA No data
Right 929803559 2:45124934-45124956 GATCTAGCATCTCATTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929803559 Original CRISPR GATCTAGCATCTCATTTTAT AGG Intergenic
No off target data available for this crispr