ID: 929803560

View in Genome Browser
Species Human (GRCh38)
Location 2:45124941-45124963
Sequence CATCTCATTTTATAGGAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929803555_929803560 11 Left 929803555 2:45124907-45124929 CCTGGACAAGACTATCAAACTGG No data
Right 929803560 2:45124941-45124963 CATCTCATTTTATAGGAAACCGG No data
929803553_929803560 17 Left 929803553 2:45124901-45124923 CCAAACCCTGGACAAGACTATCA No data
Right 929803560 2:45124941-45124963 CATCTCATTTTATAGGAAACCGG No data
929803554_929803560 12 Left 929803554 2:45124906-45124928 CCCTGGACAAGACTATCAAACTG No data
Right 929803560 2:45124941-45124963 CATCTCATTTTATAGGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929803560 Original CRISPR CATCTCATTTTATAGGAAAC CGG Intergenic
No off target data available for this crispr