ID: 929804216

View in Genome Browser
Species Human (GRCh38)
Location 2:45130456-45130478
Sequence CTTTCTCACAACACTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929804213_929804216 -3 Left 929804213 2:45130436-45130458 CCTCTTCACAGTGGCCTGAGCTT No data
Right 929804216 2:45130456-45130478 CTTTCTCACAACACTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929804216 Original CRISPR CTTTCTCACAACACTGTGGC TGG Intergenic
No off target data available for this crispr