ID: 929805995

View in Genome Browser
Species Human (GRCh38)
Location 2:45145463-45145485
Sequence AGCTGTGGCTAGGAGGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929805995_929805999 -10 Left 929805995 2:45145463-45145485 CCATAATCCTCCTAGCCACAGCT No data
Right 929805999 2:45145476-45145498 AGCCACAGCTCCACTGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929805995 Original CRISPR AGCTGTGGCTAGGAGGATTA TGG (reversed) Intergenic
No off target data available for this crispr