ID: 929807360

View in Genome Browser
Species Human (GRCh38)
Location 2:45158706-45158728
Sequence CCTGATGGTAACCATCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929807360_929807366 20 Left 929807360 2:45158706-45158728 CCTCAAAGATGGTTACCATCAGG No data
Right 929807366 2:45158749-45158771 TGAGACCAGCCTGGCCAACGTGG 0: 1677
1: 39723
2: 111562
3: 174837
4: 182495
929807360_929807365 11 Left 929807360 2:45158706-45158728 CCTCAAAGATGGTTACCATCAGG No data
Right 929807365 2:45158740-45158762 CCACGAGTTTGAGACCAGCCTGG 0: 132
1: 20824
2: 86815
3: 157828
4: 191578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929807360 Original CRISPR CCTGATGGTAACCATCTTTG AGG (reversed) Intergenic
No off target data available for this crispr