ID: 929808575

View in Genome Browser
Species Human (GRCh38)
Location 2:45169564-45169586
Sequence CCGCGGAGACGGGCGGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929808562_929808575 4 Left 929808562 2:45169537-45169559 CCACCCTCTGGGCGAACGGAATG No data
Right 929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG No data
929808565_929808575 0 Left 929808565 2:45169541-45169563 CCTCTGGGCGAACGGAATGGCAC No data
Right 929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG No data
929808558_929808575 9 Left 929808558 2:45169532-45169554 CCCCGCCACCCTCTGGGCGAACG No data
Right 929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG No data
929808559_929808575 8 Left 929808559 2:45169533-45169555 CCCGCCACCCTCTGGGCGAACGG No data
Right 929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG No data
929808561_929808575 7 Left 929808561 2:45169534-45169556 CCGCCACCCTCTGGGCGAACGGA No data
Right 929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG No data
929808564_929808575 1 Left 929808564 2:45169540-45169562 CCCTCTGGGCGAACGGAATGGCA No data
Right 929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG No data
929808557_929808575 14 Left 929808557 2:45169527-45169549 CCGAACCCCGCCACCCTCTGGGC No data
Right 929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929808575 Original CRISPR CCGCGGAGACGGGCGGGGAC GGG Intergenic
No off target data available for this crispr