ID: 929813271

View in Genome Browser
Species Human (GRCh38)
Location 2:45209916-45209938
Sequence TTGTAACATTGCAAGAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929813271_929813272 2 Left 929813271 2:45209916-45209938 CCTTTGCTCTTGCAATGTTACAA No data
Right 929813272 2:45209941-45209963 TATCTATAAGAATTCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929813271 Original CRISPR TTGTAACATTGCAAGAGCAA AGG (reversed) Intergenic
No off target data available for this crispr