ID: 929815060

View in Genome Browser
Species Human (GRCh38)
Location 2:45223830-45223852
Sequence AGTCTCCCTGAGGTTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929815060_929815067 -4 Left 929815060 2:45223830-45223852 CCCAGGAGAACCTCAGGGAGACT No data
Right 929815067 2:45223849-45223871 GACTGGCTGGGTGACTCCATGGG No data
929815060_929815068 4 Left 929815060 2:45223830-45223852 CCCAGGAGAACCTCAGGGAGACT No data
Right 929815068 2:45223857-45223879 GGGTGACTCCATGGGATGCCAGG No data
929815060_929815066 -5 Left 929815060 2:45223830-45223852 CCCAGGAGAACCTCAGGGAGACT No data
Right 929815066 2:45223848-45223870 AGACTGGCTGGGTGACTCCATGG No data
929815060_929815069 10 Left 929815060 2:45223830-45223852 CCCAGGAGAACCTCAGGGAGACT No data
Right 929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929815060 Original CRISPR AGTCTCCCTGAGGTTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr