ID: 929815065

View in Genome Browser
Species Human (GRCh38)
Location 2:45223840-45223862
Sequence TCACCCAGCCAGTCTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929815065_929815068 -6 Left 929815065 2:45223840-45223862 CCTCAGGGAGACTGGCTGGGTGA No data
Right 929815068 2:45223857-45223879 GGGTGACTCCATGGGATGCCAGG No data
929815065_929815069 0 Left 929815065 2:45223840-45223862 CCTCAGGGAGACTGGCTGGGTGA No data
Right 929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG No data
929815065_929815074 27 Left 929815065 2:45223840-45223862 CCTCAGGGAGACTGGCTGGGTGA No data
Right 929815074 2:45223890-45223912 TTACTAGTTTCGCCCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929815065 Original CRISPR TCACCCAGCCAGTCTCCCTG AGG (reversed) Intergenic
No off target data available for this crispr