ID: 929815066

View in Genome Browser
Species Human (GRCh38)
Location 2:45223848-45223870
Sequence AGACTGGCTGGGTGACTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929815061_929815066 -6 Left 929815061 2:45223831-45223853 CCAGGAGAACCTCAGGGAGACTG No data
Right 929815066 2:45223848-45223870 AGACTGGCTGGGTGACTCCATGG No data
929815060_929815066 -5 Left 929815060 2:45223830-45223852 CCCAGGAGAACCTCAGGGAGACT No data
Right 929815066 2:45223848-45223870 AGACTGGCTGGGTGACTCCATGG No data
929815059_929815066 -4 Left 929815059 2:45223829-45223851 CCCCAGGAGAACCTCAGGGAGAC No data
Right 929815066 2:45223848-45223870 AGACTGGCTGGGTGACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929815066 Original CRISPR AGACTGGCTGGGTGACTCCA TGG Intergenic
No off target data available for this crispr