ID: 929815069

View in Genome Browser
Species Human (GRCh38)
Location 2:45223863-45223885
Sequence CTCCATGGGATGCCAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929815060_929815069 10 Left 929815060 2:45223830-45223852 CCCAGGAGAACCTCAGGGAGACT No data
Right 929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG No data
929815065_929815069 0 Left 929815065 2:45223840-45223862 CCTCAGGGAGACTGGCTGGGTGA No data
Right 929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG No data
929815061_929815069 9 Left 929815061 2:45223831-45223853 CCAGGAGAACCTCAGGGAGACTG No data
Right 929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG No data
929815059_929815069 11 Left 929815059 2:45223829-45223851 CCCCAGGAGAACCTCAGGGAGAC No data
Right 929815069 2:45223863-45223885 CTCCATGGGATGCCAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929815069 Original CRISPR CTCCATGGGATGCCAGGCCC TGG Intergenic
No off target data available for this crispr