ID: 929820430

View in Genome Browser
Species Human (GRCh38)
Location 2:45269155-45269177
Sequence CTACATCAACAGAGAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929820424_929820430 18 Left 929820424 2:45269114-45269136 CCTCTGAGAAGAAAATAGAGGTG No data
Right 929820430 2:45269155-45269177 CTACATCAACAGAGAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929820430 Original CRISPR CTACATCAACAGAGAGAACT GGG Intergenic
No off target data available for this crispr