ID: 929820430 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:45269155-45269177 |
Sequence | CTACATCAACAGAGAGAACT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929820424_929820430 | 18 | Left | 929820424 | 2:45269114-45269136 | CCTCTGAGAAGAAAATAGAGGTG | No data | ||
Right | 929820430 | 2:45269155-45269177 | CTACATCAACAGAGAGAACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929820430 | Original CRISPR | CTACATCAACAGAGAGAACT GGG | Intergenic | ||
No off target data available for this crispr |