ID: 929821724

View in Genome Browser
Species Human (GRCh38)
Location 2:45279636-45279658
Sequence AGGTGGAGCTCCTTTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929821724_929821730 11 Left 929821724 2:45279636-45279658 CCCAAAGAAAAGGAGCTCCACCT No data
Right 929821730 2:45279670-45279692 TGAAAGAAATGAGAACTGTCTGG No data
929821724_929821731 15 Left 929821724 2:45279636-45279658 CCCAAAGAAAAGGAGCTCCACCT No data
Right 929821731 2:45279674-45279696 AGAAATGAGAACTGTCTGGAAGG No data
929821724_929821732 24 Left 929821724 2:45279636-45279658 CCCAAAGAAAAGGAGCTCCACCT No data
Right 929821732 2:45279683-45279705 AACTGTCTGGAAGGAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929821724 Original CRISPR AGGTGGAGCTCCTTTTCTTT GGG (reversed) Intergenic
No off target data available for this crispr