ID: 929823084

View in Genome Browser
Species Human (GRCh38)
Location 2:45289180-45289202
Sequence ATTTGCATGAGGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929823073_929823084 27 Left 929823073 2:45289130-45289152 CCCCCTTTCAAGCCCAAGACAGA No data
Right 929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG No data
929823076_929823084 24 Left 929823076 2:45289133-45289155 CCTTTCAAGCCCAAGACAGAAGA No data
Right 929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG No data
929823074_929823084 26 Left 929823074 2:45289131-45289153 CCCCTTTCAAGCCCAAGACAGAA No data
Right 929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG No data
929823075_929823084 25 Left 929823075 2:45289132-45289154 CCCTTTCAAGCCCAAGACAGAAG No data
Right 929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG No data
929823078_929823084 15 Left 929823078 2:45289142-45289164 CCCAAGACAGAAGAGAGGTATTG No data
Right 929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG No data
929823079_929823084 14 Left 929823079 2:45289143-45289165 CCAAGACAGAAGAGAGGTATTGC No data
Right 929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929823084 Original CRISPR ATTTGCATGAGGAAGGTGGC AGG Intergenic
No off target data available for this crispr