ID: 929824925

View in Genome Browser
Species Human (GRCh38)
Location 2:45302641-45302663
Sequence CCTGGGTATTAGGTTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929824925_929824934 -2 Left 929824925 2:45302641-45302663 CCTTGGGCAACCTAATACCCAGG No data
Right 929824934 2:45302662-45302684 GGGGCATTCTGGGAAATCAGTGG No data
929824925_929824936 6 Left 929824925 2:45302641-45302663 CCTTGGGCAACCTAATACCCAGG No data
Right 929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG No data
929824925_929824935 -1 Left 929824925 2:45302641-45302663 CCTTGGGCAACCTAATACCCAGG No data
Right 929824935 2:45302663-45302685 GGGCATTCTGGGAAATCAGTGGG No data
929824925_929824939 21 Left 929824925 2:45302641-45302663 CCTTGGGCAACCTAATACCCAGG No data
Right 929824939 2:45302685-45302707 GAAGCAGGAAAACCTCCCTGGGG No data
929824925_929824937 19 Left 929824925 2:45302641-45302663 CCTTGGGCAACCTAATACCCAGG No data
Right 929824937 2:45302683-45302705 GGGAAGCAGGAAAACCTCCCTGG No data
929824925_929824938 20 Left 929824925 2:45302641-45302663 CCTTGGGCAACCTAATACCCAGG No data
Right 929824938 2:45302684-45302706 GGAAGCAGGAAAACCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929824925 Original CRISPR CCTGGGTATTAGGTTGCCCA AGG (reversed) Intergenic
No off target data available for this crispr